GenePrediction:GLEAN_7103 Details

Name: GLEAN_7103
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4208133..4204382 (- strand)
Length: 3752
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4208133..4207108 (- strand)
Length: 1026
Type: CDS
Source: GLEAN
Position: GCSC_140:4207057..4204382 (- strand)
Length: 2676
>GLEAN_7103 class=GenePrediction position=GCSC_140:4208133..4204382 (- strand)
ATGGATGCTGTCAACTTTGATATCAACAATGCGCTCAAGCATTACATGAGCGACCCGGCAGCCATCCCGACGCCCGAGGC
CGCCTCGTCGCTATACGACTGCGAGAACGACCCGGAGTCGTTGACGAATGCCGTGGTCAACCCAGTGCTGAACCCCATTG
TCGACGCCGTGGCCGAGAGCCCGGACGCGATCACACGCAGCCTCTACTTTGACTCGCTGCAGTTCCTTCTCAAATACACG
TCCTTCCTGCCGACACATGCACTCAGCAAGGTGTTTGACCTCATCACGTCAGGCCTGTCGGCCGAGGCAGATGCGGTGCA
CCACGATCTCGAGTCGGACGAGCAGGACCTGGTGGCCCATCACAAGCAGCTACTCGAGATCTATGGCTTCCTGTTGCAGT
GGACGGTTTCTGCGGTAGAGACGCGCGCAGCCGAGAAGTCGTCGGCCGCGCCGGCGGCACGCCGCGGCAAGGCCAAGGCG
GGCGGTGCGGGCAAAAAGGGCAGCACGGCGGTGGCGGACGACGGCAGCTGGGACTCGTCGGCGCAGCTGCAGACAGCTCT
CGAGACGATGTGCAAGGTGCTGCGGCTGAAGCTGTCCAAGATCTTCCTGACAACGTCGGAGCGCGACACGTTTATCGGGC
TGCTCACGCGGCCGGTGTACCTGATCCTCGAGAGCGAACAGCGGGTCAAGTCGACGGCAATCCGCATGCACGCCTTCAAG
GTGCTCTGCATGGCGGTCAAGCACCACGGCCACGGCTATGCAGCGCAGATCTCGATCGTTCAGAACCTGACGTACTTTGA
GCACCTGTCGGAGCCCATGGCCGAGTTCTTGCACATTCTGTCGGAGCAGTACGATTACGAGCAGCTGGCCAATGAGATTC
TGGTCGAGCTCAGTAACAAGGAGTTTAGCAGCAACGACACGCGAGGACCCAAGTCGGTGTCGAGCTTCATCATCAAGCTG
TCGGAGCTGGCGCCGCGGCTGGTGATCAAGCAAGTGGCATCGCTTATTAAGCAGATGGACAGCGAGGTAAGGGACAAAGG
GAACGGAGAGGCTGCACGAGCTAGCTGACAAGACAGTCGTACACGCTGCGCTGCGCGCTGATCGAAATCTGCGGCAACAT
GATCGCCTACCTCAGCCAACAGGAAGAGCGCGGCGAGGACCACAAGTCGCAGCTAAACGCCTTTTTCAGCGTGTTGGAGG
AGCGGTTCCTCGACATCAACCCGTACTGCCGGTCACGCACGATCCAGGTATACACACGGCTGTGCGAGCTCGAGATGAAG
TTCCCGAAGCGGCGGTTCCGGGCGGCCGAGCTGGCCAACCAGAGCCTCGAAGACAAGAGCAGCAACGTGCGGCGCAACGC
GATCAAGCTGCTGGGCTGTCTGATCAAGACGCACCCGTTCATGGCGCTGCACGGCGCACAGCTGTCGCGCAAGGACTACC
AGGAGCGGCTGGAGCTGGTGGACCGTGAGATCCAGGCGCTGCGGCCACCAGAAGGAGCACCAGACCTGGGCGAGAACGGC
AACGCGACGGGCCTTGTGGACGATGCGACACAGATCGAGGCGTCGCCGCAGAAGGCTAAGACGGTGGCGGAGATGACGGA
TGAGGAGAAGGTGGCGGCGGTGCTGAAGGCGCAGGAAGAGGCGGCGACGTCGGAAAAGATCAGCCGGCTGACGGTGGCAC
GCAAGTACTACTCGGAGGCGCTCAAGTTCATCCGGATTCTGCACGAGGCGACGGAGACAGTGTGCCAGCTGCTGGGGTCG
CGCAACAAGAGCGAGGTGATCGAGGCGATGGACTACTTTGAGATTGGCGATGCGTACAACATTGAGAACAACAAGGTTGG
GATCCGGCGGATGCTGCGGCTGATCTGGACCAAGGGCAACAGCGACGAAGGCAAGGGGGTGCAGATGCACCTGATCGACT
GCTACCGGCGGCTCTTCTTCGAGGCGCCGGACTCGTTTGGACCCAACGACGCGGCCAACTATGTGGCACGCAACATGATC
AGCCTGACATTTGGGGCGACGCCCGCAGAACTGACGTCGCTGGAGCAGCTGCTGGCAACGATGATGAAGGGGGGCCTGAT
CGCAGATGTGGTGGTGGCGAAGCTGTGGCAGGTATATGGGATCCAGCAGAAGGAGATATCGCGGAAGCAGCGTCGGGGTG
CGATCATCGTGCTGGGAATGCTGGCGACGGCGAGCCCGGAGATTGTGGTGGGCGAGATGGAGACGATGCTGCGGACAGGG
CTGGGCCGTCACGGGCGAGCAGACCTGCAGCTGGCCAAGTACACGTGCGTGGCACTGCAGAGGATCAACCCAGGCGGCTC
GGCAGCGGTCAGCTTCGTGCGGCTACCCAACGAGCATGCGGTGCTCTTCCGGCTGGCAGCCATGCTGGACGTACCATCGG
ACGACAAGGAGTGGTTCGGGGTGGCAGAGCAGGCGGTCAATGCGATCTACGCGCTGTCGAAGCATCCAGACGTGCTCTGC
TCGGAGATCATCCGGCGGAAGACACGGGTGGTGTTTGGGGGAGGGGCTTCATCGGCCGGAGCTCGACAGGAATCGCCGTC
GTCACGGCCGGGATCACGTGATGCGGGCGATGCGACGGTGGTGGAAGGTACTGGAGAAGACTCAAGCCTGGGCGAAGTCG
AACAGGACCAGAGCAAGAACAACACGATTGCACTCTCGCAGTTGCTCTTCGTGGTGGGCCACGTAGCGATTAAGCAGATT
GTGCATCTGGAGCTGTGCGAGCAGGACTTTAAGCGGCGCAAGCAGGAGAAGGAGAAGGAGGGCGCATCCAAGGAGGAAGC
AGCAGCAGCAGCAGCAGCCAACACACGACGACCGGGACGCGGCAAGAAGAGCAGGGCGTCGACAGCAGCACCGGAAGAGG
GCGACGAGTTGGACCTGATCGGCGGGACGACGGAGGACGACTTCACGGAGGCGATGCAGCACATCCGAGAACGGGAGCTG
CTGTACGGACCGACGTCACTGTTGGGGATGTTTGGGCCGCTGGTGTCGGAGATCTGCGCGAACAACACGTCGTACCGGGA
CCGGGGACTGCAAGCGGCAGCGACGCTGTGCATGGCGAAGCTGATGTGCGTGAGCGCCGAATACTGCGAGGCGAACCTGC
CGCTGCTGATCACGATCATGGAGCGGTCGGGCGACGCGACAGTGCGGTCGAATGCGGTGATTGCTCTGGGTGACATGGCA
GTATGCTTCAACCATCTGATCGACGAGAACACGGACTTTTTGTACCGGCGGCTGGCCGATGCGGATGCATCAGTCAAGCG
GACCTGTCTCATGACGCTCACCTTTCTCATCCTGGCCGGTCAGGTCAAGGTCAAGGGCCAGCTGGGCGAGATGGCCAAGT
GTCTGGAGGATGGCGACAAGCGGATCGCCGATCTGGCCCGCATGTTCTTCACCGAGCTTTCGACCAAGGACAACGCGGTG
TACAACCACTTTGTCGACATGTTCAGCCTGCTGACAGCCGCGCCGACGTCGGGCGGCGGCGTGGGCGGACAGCAGAAGCA
GCAGCCGCTGAGCGAGGACGCATTCCGGCGGATTGTCCGGTTCCTGCTCGGCTTTGTCGAGAAGGACCGCCACGCGCGAC
AGCTGGCCGAGAAGCTGGCCGCACGGCTGAGCCGCTGCGAGACGGAGCGGCAGTGGAACGACGTGGCATTTGCGCTGGGG
CTGCTGCAGCACAAGAGCGAGGACATCAACAAGGTCCTGTCGGAAGGCTTCCGGGTGGTGACGATAGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62