GenePrediction:GLEAN_7105 Details

Name: GLEAN_7105
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4199321..4198218 (- strand)
Length: 1104
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4199321..4199201 (- strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_140:4199148..4199128 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:4199065..4198934 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_140:4198867..4198218 (- strand)
Length: 650
>GLEAN_7105 class=GenePrediction position=GCSC_140:4199321..4198218 (- strand)
ATGTCGGCAGCAGCACCTGTTGCAGCTTCGGCTGATGCCGAGGCTAAGCCGCAGAAGAAGAGTGCACCGAGCGCATTGCG
GTCGATTCTGGCGGGCTCAACGGCCGGCGCAGTTGAGATTTGTGGGTGGCAGTCCAGGGCATGCTGTGAGGCTATAAAGC
TAACGTGTGGCAGCCATCACATACCCGGCCGAATGTACGTGGACCTCCTCTCTGAAGCAATGCGACCGACACGCTGACAA
GGACTCCTCACTGCAGTCGCCAAGACGCGCACACAGCTGAACCGACGGCTGCCAGACGGCCAGAAGCTGCCGTGGCCGCC
CTTTGGGCGACAGTGGTACGCGGGCTGCACGACGCTGATCATTGGCAATTCAGCCAAGGCCGGGATTCGTGAGTGGAACA
AGACGAGGCAGGGGGATGTATCAAGAGAGACACCGACAAAATGCTGACAGACAGGCTTCGTGGCCTTTGACCAGTACAAA
CGGCTGCTGGCGGACGCGGACGGCAAGCTGTCGGGTCCGCGAACGGTGCTGGCGGGCTTCGGAGCGGGCGTGACGGAGTC
GCTGCTGGCGGTGACGCCGACGGAGAGCATCAAGACGACGCTGATCGACGACCGCAAGTCGGCCAAGCCGCGGCTGCGCG
GATTCCTGCACGCGGTGCCTATCATTGCGCGTGAGCGCGGTCTCCGCGGCTTCTTCCAGGGTTTCGTGCCGACGACGGCA
CGTCAGGCGGCCAACTCGGCCGTCCGCTTCTCGTCCTACACCTTTCTCAAGCAGCTGGCCGAGAGCTACACGGCGCCGGG
CGAGAAGCTCGGCACGGCCGGCACCTTTGCCATGGGCGCGCTCGCCGGCACCATTACCGTCGCTGTCACGCAGCCGCTCG
ACACCATTAAGACGCGCATGCAGAGCATCGACGCCCGCCAGCTCTACGGCAACAGCGCCCGCTGCGCCGCCCTGATCCTG
CGCCAGGAGGGCGTGCTGACGTTCTGGAGCGGCGCCCTTCCGCGCCTCGTCCGGCTCGTCCTCAGCGGCGGCATCGTCTT
CACCATGTACGAAAAGAGCATCGATCTCTTCGGCCGGCTCGACCCGGACGGCAAGTACATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62