GenePrediction:GLEAN_7109 Details

Name: GLEAN_7109
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4191345..4187903 (- strand)
Length: 3443
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4191345..4191247 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_140:4191170..4190719 (- strand)
Length: 452
Type: CDS
Source: GLEAN
Position: GCSC_140:4190638..4189543 (- strand)
Length: 1096
Type: CDS
Source: GLEAN
Position: GCSC_140:4189499..4189355 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_140:4189285..4189226 (- strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_140:4189143..4189096 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:4189030..4188819 (- strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_140:4188604..4187903 (- strand)
Length: 702
>GLEAN_7109 class=GenePrediction position=GCSC_140:4191345..4187903 (- strand)
ATGAGCAGCGACACCACCGAAGAATCCTCCACCAAGACTTCGGGTGCTTCCTCTCTGGCACCTAGCACGGCATTGTCTCT
CGAAACCAGCGTGACTTTGGTGAGCATATGCCTCCTGACGATATTTGTGCTGGAATTGGACTTTACTGACCATTACGCCC
TCGCTTTCTACACAGGCCGTGTCTATTGATGACAATGATGCATCTCCACCGCACTTGCCCGGCTCGTCCGAGGAGAGCCA
GCACCCGGTGGATCCTAAAGTACCGGGCAAGAGTGATGGTATCCGCGACGAGCCTGAGGCAAATGTAGCGGAACCCACCA
GAAGTGAGATCGAAGCTCGTTTTGCGACCCTTCGCAGGAAGTTACGCTATGGCGATTACATAAGCGAATCGCGCCTCTTT
GACGACGACGACAAGGCCACATTTCTTCTCAAGTCCATGAGATCGGTGCAGTGGATTCACGAAGCTCTCACCGCCCTGAA
CACAAAGAAAGAGCCCGAGGAGCCCGAGCCGACAGTGCGTCTTATCGCTACCCCGGAGGCCAAGCATTTGACATGGAAAG
AATGGGAGGCGTCGTCGGGATCTAACAGTGTGCCGCACTCGGCCTTGTACATCTTGTCTGAAGAACCGTCTTCATCGTCT
GGGCCAACCGCAACGCCACCGATGGGAATGTCCGAATTTCACAGTACTAATCCGAAGGCCCTTCGAGCAATTCCATGGCC
AAGCAGCTACCGTCGCGCATCCGCATTTGTTCGTTGGCGGCCAAAAGGATTATCGACACGATGTTTGACGACAATATACC
TTGGAGCAGCAACTGCCCGATTGTACTTCTGCGTCCATATAAGCTGCTGACTTATTACGACCAGAAAATTCGAGATCGTC
TGTCCGAGCTTGAAAAGTCCTGCAGCGACCATCTCCAACAGACGGCCGACGAGAAGGAGGCCGAGATTGAGACTGGCGGT
CGCTTCGAAATCGAAGGAACGCAGATCTTTGCTACGGGCACAAACTGGAGCACCCTCACGCTGAAAGAAAAGCAGGAGGC
TGCCAAGGACCTGCGCGTCGTGGTATCGTTTATGGACGAGTACCTTGCACCGCTGGCGCCTTCGGGACTTCTGTTCAGGG
CCGAACGCCTTGTACGCTTCAGCGAACTCTGGCACTTCTTGATTCCTGGCAGCCTAGTTTACGTCCGCGACCGGACCGTT
CCGCAGAAGATCTGGAAGGTGCTGCAGGGATCTGGTGGCCGCAGGCCTTTGTCCACCAATTCGGACTCTGCTGATGCGCT
GGCGTTGGGCGCTCGCTGGCTCCGAGAGAAGCGCAACCCGTTCAGTCTGGACTGCTACTATATCGATTACGACGGCACCG
ACTTTGTGCGCGTCATCCGGACCTTCACCATCGAGGAGTTCCCTGATGCGCAGCAGGCAAAGTTGCTCCAGATCCTACCG
ATCTCAATCGCGGAGCAGGAGGGGCTCGTCAAGGAAAGAGACCTGATGGAGAGGGGGAAGGCTTTCATAAAATGCGCGAC
TATGCCCTACAAGTACATGTACTACCGCGGCCGGAGTCTGAGCCATGCCCCCAATGGGGACGTGTTGACACGGCCTTTTC
CAGGAAGCCTCGGGAGCATCGCGGTGCTCTCCGATTTCATCGAGAGTCCTGTAGTGGTGGACTTTGAGAGATGCCTTCAG
CTCGTACCGGACTGGAGCCCGACAAGGTCGACCGAGGAGCTGCTCAAGGGACCGGAGAACGAATTGAATGGCGACGGAGC
CGACGATAATATAGAAGACGACCGCGTCTGGGATGTTCGCATGGTTGAAGACATGATCGAGATCACTGACCCCCCCCCGA
GAGAAGCTGAAGGAAATACTACCAAAGAAGGAGGCATGGGAAGATCTTCAGATCAACCTTTCGCACAAAAAGGTCATCGA
GTCGCTGATGCGGTCTCATTTCGAGAAGAGCAAGTCGCAGCGCCGTCAGTTTGACCTGATCCAGGATAAGGGTAAGTGCA
GACAATCTGAGGATTCTTATCGATCGTGGAGTAGATAATAACACAAGACGTCTTTTACAGGCAAAGGCCTCATCATACTG
CTGCATGGTGTTCCCGGGGTCGGAAAGACCTCCACTGCAGGTACGTAATTGACCGGTTAGAATGAACGTATGGAGCAGAA
CGTTCTGAAGAGTTGTGTCTAATTTGCGAATACAAAACATAGAAACGGTGGCAGAGTATTACAACAAACCTCTGCTGCCG
ATCACGTGCGGTACGTTCCCATCTATCTAAATGTCCGACATTCCTTGCAATATGTGAAGAGACTGATGGTGACAGGCGAT
TTGGGGCTCACCCCACAGGACGTTGAGAAAAACCTGCAAAAATCGTTCGCGCTTGCCCAGGCATGGCAGTGCGTCCTCCT
GCTGGACGAGGCGGATGTGTTCCTGGCTGAAAGAAGTCGCGACAGCATCGAGAGGAATGCTCTGGTGTCCGTCTTCCTAC
GCGTCCTCGAATACTACGAGGGAGTCCTTTTTCTTACGACCAACAAGGTCGGTTCATTCGATGAGGCCTTTAAGTCGCGC
ATCTCCATGGCCCTTTACTATCCACCGCTGTCTATGGATCAGACTCTGACCATCTGGAATACGCAGATACAGCACACCCG
CAGCAACAGCAAGGCTGCCGCGCCCGACGACCCGACGCAGCATATTAGCTTTGATGAAAAGGAAATAACACAGTTCGCGT
TGAAGCTGTGGAAACCAGCAGGATAGGAGACCGGAGTTCAAGCCGGTGTGGAATGGCCGGCAGATCCGCAACGCCTTCCA
GACCGCCGTCGCGCTCGCCGAAGTCCAGCAGAAAGTGGGGATGGGAATCAAGGTGACAGAGTCGCACTTCGAGCAGGTTT
CGCTGGTGTCGAACGAGTTTAATACTTACCTGTGGCGGACGAAGCTGCAGCGTGGTGACGACGTGCTGAATCTGAAGAAG
GGGTACCGCGACGACACGTTCCGGGACACAGTGCCGTCCTATGCAAACGATGGCTACGCGAACAATCTCGCGATGGCGAC
CATGCAGAACTTCACACCGCAGGCTACAGGCGCTCCCGGTCCGAGCTACCCAGTTTCGAGCATGCCCATATGGGGTAGCC
ACAGGCAGGATGGCAGTGGGCAGCCAGCGCAGGCTAACAATGCCTCTTTCATGCCTGGCTTCTCTCCCTTTGGAACTCAG
CAGCCGCCACAGCAGCAGTCATCGTTTCAGGCGTCGGGATACCAGCAACAGCCAGCACAAACATCGGTCTATGCTCAGTC
CGGCCAGCAGCAGCAGCAGCAGCTGCCGGCCAGCTACGGCAACGCGGGAGGACAGAGTTTTGCCGGTGGCGGTCCCGCGG
GATCGGGGGCCCTACAGCAGGGACAAAATCAAGGCTTGCCTTCACAGCAGTCCTTGTATAACCATCATGGCTATTCTGGA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62