GenePrediction:GLEAN_7111 Details

Name: GLEAN_7111
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4181110..4178461 (- strand)
Length: 2650
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4181110..4180957 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_140:4180902..4179348 (- strand)
Length: 1555
Type: CDS
Source: GLEAN
Position: GCSC_140:4179250..4178829 (- strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_140:4178744..4178461 (- strand)
Length: 284
>GLEAN_7111 class=GenePrediction position=GCSC_140:4181110..4178461 (- strand)
ATGGCCGATGGAGGTGATCCTGACAGTGGACCTCGGAGGCGACGACTCCGACATGTCTCCAGCAGACGTGGAGACAGAGA
TAAGCTGCGAGAGTGTCCACACTGCGGCCGCACCTTTAAGCGCACGGAGCATCTGGAGAGACACGTGAGGACTCGTATGT
GGCCCACGATCTGTGAAGTCTGTTTGGAAGCTGATTGACTGGCGAAAGATACAAAGGAGAAGCCGTTTGGCTGCAACCGA
TGCGGGGCTACATTTTCACGCCGCGACCTGCTGACGCGACATCGCCGCATTGCTCTTCACGATGATGAGTCAGCAACGGC
TGGATCGCCCAGGCAGACGTCTGAGATGGCCGGACCGGAGGTGCACTGGACGCAGCCGTTGACAGAGGCGGATGTGTATG
CTGCGGCGGGCGACGCGGCACAACAACACGAAGTGATGGCTTCGTACCAGCCGGCGCTGTCGGGGTCCTTTTTCGAAGGC
ATCGAGGAGCCAGACAGCAACACCACGTTCGATGCCCATTTCATGGAGTTTGCCAACTTCCTCGACGGCGTGGGGCTGCC
GGCCGAATGGAGTCCGTACTTCCACGGCCCCGACAGATACGAAGGCGGACACCCAGAAGCGAGGACCGTTCCAGATGCGT
CCACGGCTTCGCCTCGCCCGGCTCCGAGAACACGGCTAGGGACACCGTTCAGCTCATGGCTGCCATCGGCACCGACAGGC
AACCGGATCTCCGACAATCTCCCGGACGAGAGTGAGCTCGCTGTGCCAGGCCCGGTCGAGACCAGCGCGGAACACCAGCG
GTTCCGGGTGACAGACGAGCAGCGAGCAAGGCTATGTGCCGCCTTGGAGACGTTCCGCGACATTGTCGGCCAAGACGTCC
GCATTCCAAGCCGTCATGCCCTCACGCGATACACCTCGTCTTTCTTTGACGGCTTCCACTCCCACCTGCCGCTGATCCAC
ACACCCACCTGGCACTTCTCTGACCACGCCCCCGAGCTGATCCTCGGCATGGCCGCCATCGGGGCCCAGTACTGCTTCGA
CCACCGCGTTTCCGAGAGTCTGTTCCGTGCCGGAAAGGCCATCCTGATCGAGAGGCTGCTGCACGAGGCCGCCAGCCGCC
CGGAGCCGCGGCGAAGCTCGTTTCTGGCCCTCCAGCCGATGGTGTCGTCGTCCGCGCGCGACTGGGGCTCCTGGGATCCG
ATCGAGTCGGTGCGGGCACTCGTCTGCCTCATGGGATACGCCACGTGGGAGCCAAAGGTCGCGCTGCTGCAGGACTCGTT
TGCCCTCCGGGACTTGCTCGCACAGCTGCTCCGGGATGTCAGGCTTGCCGAGGACGAGCGAGAAGACGAAAGAGAGGATT
GGCAGGCCTGGATTGCCCGGGAGTCGTCGAGACGGTCCAAGCTGATCGCCTTTTCCTTCATCCACATCCACAGCATCGCC
TACAACGTCTATCCGGTGCTGCGCGCCAACGAGATCGGTCTGCGGCTGCCCTGCTCGACCCGCGAGTGGAAGGCGCCCAC
CGCGGCCCAGTGGCTGCTCGCCCTCCACGGCCGCCCCAAGCGTCAGCTGCTCTTCCAGGACGCCCTCTCGCTGCTCTTCG
GCCACGTCGACGGCACCACACCGCTCGACCCCATTCCCACGCCGCTGGGGAACTACGTGCTGCTGCACGGGATCCTTCAG
CGGATACACCTCGTGCGCGATCTCGGACTGCCCACAACAGACCATGCAGCTGCATTGCCCAAGGGGGAAGCCGACACTTT
AGAGTGAGTTTTCGGTTGTTTTTCTTTTTTTCTTTTTCTCTTTTCTTTTTCTTTTTCTTTTCATATTTCCCTCCATTATT
CATCCCCCACTGACCCCCAGACGTGGCCTTCGTTCGTGGACGTCTGGCTGGCAGCAGGCCCCCGAATCGTCCCTCGATCC
GAACAATGAGAACGGCCCGATCCCGTTCACGTCTAGCTCGCTTCTCGCACTGGCATACGTGCGCATCTACCTCCATCTTG
GCCCCTACCGGAAGCTGGACACGCGCGATCCGGTCGTGATCGCCGAGGCCATCTACCAGGCTCCACAACTGAAGCGCAAC
GACGGCGTGATTGCGGCCCTGCTCTACGCCACACATATGCTTAGCATACCCGTCCGCCTGGGTGTCGACCGGGTCGCCCG
CAGCCAGGCCTTTTTCTGGAGCGTGCGCCACAGTCTGTCTGGACTCGAGTGCGCCATCCTGCTCAGCAAGTGGCTGATGC
AGCTGGGAGGAGCTGCAGAGTCGGTTTCTCCTCCGTTAAGTGGTATGCTGTCTTTCTTGTAATTGTGGTGGCTCGACTTT
AGCTGTAGTGCTACTTCACTCAGGTAATCATAGCTAACATTCCTAGACAGCGAGGATCGGATCCTGCACTGGGTCCGGAC
CATTGTTGAAGAAGCCTACAGCGTCATTGATCTGGAGAGTGACAGCTGCGTCGGCACAGATGGACTGCCGCTGTCCGACT
TCAAGGACTGTACGAACTTGGGCCTCGCCGTCCTCAAAATCTGGGCCCATTTCTTTCGAAGCAACACCCAGTGGCTGTTT
ATCAACGTCATCGGCGAGAGCCTGAGAAAGTACCGAGAAATGCTGATCAAGGCTCAGGCGCAGAAAGTAGGATCTATAAC
TGGCATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62