GenePrediction:GLEAN_7114 Details

Name: GLEAN_7114
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4169691..4169129 (- strand)
Length: 563
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4169691..4169521 (- strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_140:4169438..4169297 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_140:4169244..4169129 (- strand)
Length: 116
>GLEAN_7114 class=GenePrediction position=GCSC_140:4169691..4169129 (- strand)
ATGCCCATAACGTATGGCCCGTCAGTAATTTCCGACTTCGGTGCTGCTCGTCTCAGGAAACCTGGCGAGAAGTGCTCTGG
CGATGTCATGCCGGGAGTGTATAGAGCACCCGAAATCATTGTTGGCGCGCAGTGGGGTTCTAAAGTAGACATATGGTGTA
TTGGCGTTATGGTATGTGGCGCGGTGCTTAACCAACTGGACTGGAGTTGTTTTTGACAATAGTGACCGTTGCAGATTTGG
AACCTGTTTGAAGGCGGTCGCCTTTTTCGCGCTGTCAAAGATGGCCGTCTTGACGACGAATAGCACCTTGCCGAGATGGT
CTTTCTTCTTGGTCCTTCAGCCAAAGGAGTTCCTGGAGATGAGCGAAAAGTGCCGACACGATTGGGATGTAGATGGTAAG
TTGGCTATTGGGGGGGTATTTGAGCTCTGCTAACTAAAATCATAAAGGCTGCTGGATTGCGTCCACACCCATCCTAGACC
GAAGCATCGAGAGTCATGAGACGCGTCTGGAAGTCAAGGAAAAAGAGCTTCTTGTGGCATTAGCTAGAAAGATCCTGCGC
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62