GenePrediction:GLEAN_7117 Details

Name: GLEAN_7117
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4127918..4125187 (- strand)
Length: 2732
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4127918..4127633 (- strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_140:4127363..4127196 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_140:4127033..4126664 (- strand)
Length: 370
Type: CDS
Source: GLEAN
Position: GCSC_140:4126462..4126456 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_140:4126138..4125901 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_140:4125674..4125187 (- strand)
Length: 488
>GLEAN_7117 class=GenePrediction position=GCSC_140:4127918..4125187 (- strand)
ATGGCCTGGGACCGCATCTCAACAGAGAGCGCCGAGATTGTGGCGTCTGGAAAGGATTTTCACACGCGCATTCAGCCGTC
GGCGGCCTGGCACGAGGGAATTGATGCTTATCTCGCACAGATCGATTTCTTCCACCAGAACGACTGCCTCAATGTTTTGC
GCGAAAACCACTTCCGCGATCATTACTTCTCGGCCACGCAGTTCACGTCCAAGATCCATGGCGCTTACACGGCCCAATGC
ATTCACATGCTTCTGCAGGCGCTCAAGGCGGAGACACAACAGACTTGTCGTTTTACTTATAATACTACGGCTATACATTG
TATCTTTCTGTTTTGCCTTGTCTCGTCGTGGTGTTCTTCCCGTTACGGACTGTATTGATGCTTGGACCTGAGCTACGGAT
TCAAACTACTCTGTTTATGGGCAATAAAGAGCACACAGACAGCAACATACTCCGTAATGTAGCATCAAAGTAACGTCGCT
AGGGAATTTAAGCATACAAATATGACTTCTGATAGACGGAACCGAAGTTAAGCTGCTTCTAGCTGTGTCACATAGTACAA
CCAACCGCCGTATTTCCTGACTATCTCCAGGGCGAGTGCTCGTATCCGGACATTGTCATCGGAAATGGCCACAGCACAAG
CAGCTGCAAGTGCAGCAACATGGACGAGGAAGACGAGCCCCGCTGGACGGATCTGCAGCTTGCCGCCAAGGACGGCGACA
TCGGTCATGTCCAGGCCCGACGTCGCCGCGCCGGGAGGAAATAACAGCATGCGGACGTCCCTGCAGCTAGCATGTGGAGG
GGTAGAAGAGAGACGAGAACGAGGCAAACGAGCCAGACCAGGTGAGATGTCAACGCGTCTCCGTCAACGACGGCCGGCCT
CGCAGCTCTGCAGGCTGCTTATCTGCTTCTGGCTCCTCTGGCCGTGGTCCGGGCACTGCTCGAGGCCGGAGCCGACGTCA
ACGCGCCGGTCAGCCGTCACAAGGGCTTCACTGCACTGCAGGCAGCGTGTATTGCCGATACTAAAAGCAACAGCATCACC
TACACAAGCCATCCCCTCGTCGAGCTGCTGCTCACTGCTGGTGCCAATACTGACGCGCCTGGAAGCAGATATCTCGGCGC
CAGTGCGCTCCATGCGGCCGCCCACATGGGCCATGCCGACATTGTGCAGTACCTACTCTCTGCAGGCACCAGCGTCAACT
TGGTTGCAGGTCCCTCCCAACAAACACCGCTGCAAACAGCCCTATTCAATGACCAGTAGGAGTGTGCAGACATTCTGCGA
CAGGTCGGTGGAACCGTCAATCCATCCCGAGCGCGGTTTCTGTTTCACTATTAAGCTGTCCTTGTCGTCTCTCGTTTTGG
TGGATGGTTGGGGTAGGAACTGTCAAACACATGGATGCATTCATACAAGAAATTCAAACCAGCCAACGGGATACAGCTGA
ATGACTGGGCCCATAGTTCTCACGTAATACAAGCACGCACAGAGTGCGCTGCCCCCTTCCACCTGCTCCTTCCTTCCTTG
TCCGTTTAGCTCCTGCCAAACACCTCTTTTACTATCCGCCGTCTTCCGTTCTCCTCATCCCTTCGCAATGGACTTTCGCA
AGAATAGACCTCGTCTGGCTGCCTTCCTCGTTTCTGTCATAGTCGTCACAACTGCAGTCGTACTTATTGCGTCAGAGCAC
AATCTTTCCAGATGGACTCTTAGGCCTACCAGTGGACTTCAGCACCACACTTCTATCCCCGCCATCCGGAAAGACTGCTC
ACCACACCAACATCTGACAGGATCTCTCCTGGGAAGAATGCCAATCTGTCGTAAAATGGCTGCAGGGCATAGACTCGGGA
CTTGACTGGACGCCCCTCGACAACTACACTTCCAGGTCCAACGTCATCCTCGTAACACAGCCGCTGCGACCAAATAAATC
TGACGCACTCGCCTTTTTGGACAATCAGCAGCCACCACCGCCTCGATTTGCCCGAGTGTCCATCAAGATGAACGCGCTCG
ACACACCGGTGATAGAAGGTTAATCTCGACATTTGGGTACAAACAACACGCTAACTCGACTGCGCGTTGTGCCGGGCACA
GAAAAGACGCATTACTACCTCTGAGTGGCACTAAGTGAGGCTATGAACACTGAGGAGCTGCATCGCAACCTTATGCCCGT
CGAGGCCGCCGTGAACTGAGAGCTTGGAACTATGTATGTCGTTGGTGCTACTCTAGACCATCTGGTCTACTCAAAATCGG
CTAGGCTCGCTTCGAAACACTATCGTACCGCATCGTTCCGGTTATGCCGCCCATCTACCTCACAGTTCGAAATTCCACCC
TTCCACCGTGCTGCAGCGTGCTGCCGCCTGGGTGGACGCGCTAGAAAGACTCAGAGCCGCACTCGTCTATTTCAGCCAAC
GCCCTCGACCTGGCCAATCGCTCGTCGATTTTTGCCAGCTCGTCAACGGCGAGTCCATCTCCCAGGGCGACGACCTCGTC
CTATGGCTCAATCTGGGCATGCATCACGGGCTGCACCTCGGAGACCTGCCGAACACTCTAACCACGACCGGCTCCAGAGC
CATCCGGTTTGTTCCATACAACTACCTTGCACGCGACCGTGCACGTGGTCTTGCAACCGGCGTGCATCTGCAGCACGCCG
GCCAAGGCGGGGTCGACGATGTTTGGGCCGTGACCCCGCTAGGAGCCGGACAGGGGTCGGTGGAACGGTTGGACTTTTCG
GCGGGCCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62