GenePrediction:GLEAN_7122 Details

Name: GLEAN_7122
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4114595..4111385 (- strand)
Length: 3211
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4114595..4113888 (- strand)
Length: 708
Type: CDS
Source: GLEAN
Position: GCSC_140:4113830..4111779 (- strand)
Length: 2052
Type: CDS
Source: GLEAN
Position: GCSC_140:4111426..4111385 (- strand)
Length: 42
>GLEAN_7122 class=GenePrediction position=GCSC_140:4114595..4111385 (- strand)
ATGCCACCGGGAGCCGTCGAACTCGCTGTTCGCCATAATGACTCAGAGGCCGACACCGACATCATTGCCATCCACGGCCT
TGACACGAAGTCACCTGATACTTGGACATGGAGGCAGGGTGATGTTAGTGTCAACTGGCTATCCGATGTGAATATGCTCC
CGAGCAGAGTCGGGAAGGCCCGGATCCTCACGTGCGATTGGTCCGCAGACTTGCTTCAACCAAAAGACATGAGTCAGAAA
TCGGTGAAGGAGTACACCAGACTCATTCTCGACGGGATCCAGCGTGAACGTGCCGAGCATGAAGATCGTCCAATCATATT
CATCGCTTCGTGTCTTGGGGGCATCATCTTGATTCAGGCTCTCGTCATGGCCGGATCAGGATATTCTTCAGTCTGTCAGG
CCACGCGCGGAATTGTCTTCCTTTCTACGCCGTTCCGTGGCACTTCATTCAAAGATATAGCCCCCTGGGCAGAGCCCGCT
TTGTCGATATGGGCTTCCGCGACAGGCCGTGCAGTGACTGAGTTGACCAAAAACACCACGCAGTCGTCCAACCTTGAAGA
GCTGCTACGCCAATTCACGAAGCTTGTTAAGGACCGCGAAAAGGAGTCTGAATTAGAGCCCAATCTGAAGATTCAGCTGA
TCACTTTCTACGAACAGCAAATGACGAAACTTCTTCATGAGTACTTGTGGTTTTCGAAAATGAAACTGGTACGCAGAAGA
GAGGAAGCACTTCACTACAATCACAGTACGACTAACGTACTCTAGTTGGTCGATAGCGATTCCGCGAATCTGGACATTGT
CGAACACCCGATTCCGCTCGATCGCACCCACGTGCTCATGAACAAGTTCGCCGGGCCTAGGGACCTCGAGTATGAGAAAG
TTGCTGGCAGAATCGAGGACTTTCTTCGCAGTAGTCGCAAAACGTTCTTTCTTGACCGAGCAGATGCGTATATAAAAGAG
AATTGCGAAAAGAAGCTCACAATTTTACGGCTATCAGGCGACTCGCTGCCGATGAACCAGTGCTATATCAATCTTGCTGT
GGTGGAGCAGCAAGGAACAAAAACAGCAAACTCAGCTGAGAGGGATGCAAAGGTCTCCCCATTTAGCCTGAGCCACCGGC
TAAGTGTCGACACGCCGGACAAACAGACCCAAATCGTACTGTCGACAATCTTTGAATCACGCAAAAATCGTGACGGGACC
ACGAAAACGCCAAGACGAATTTTGATTCGAGGACGTGCAGGAGTCGGAAAGACTACATTATGCAAGAAGATGGTCTATGA
ATTTGTCCATGAGCACAAATGGCAGCCCTTGTTTGACCGGGTTCTATGGGTACCTCTACGGCGACTGAAGAGGTGGAGCT
CGGCCTCCTACACGTTCGAAGAACTGTTTCGTCGTGAAGTGTTCCAGAATTGCGAAGAGGCGTTGCGCTATCTTTTCGTC
AGAAGCCTTCGCAGGGCCTTGGACGAAGACAGAATCTTGTTTATTCTTGATGGATTGGACGAAGTGTCCCAAGAGTGGGC
AAGGGACAACGATGGCTACGACTTTCTTCGAGATCTCCTAAATCAAAAGAACGTTGTAGTCACATCTCGTCCGTATTTCA
AACTTCCGGATGGCATCAACCCTATGGATCTCGAGCTAGAGACACTTGGATTCTACCCAAAACAGGTGGAGGAATACGTC
AATACGACATTTGGCAATTCTGGCACACAAAAGGCCGAAGAAGTCCGTTTGTTTCTCCAAACTCACCCACTTATTCAAGG
CCTCGTTCGGATTCCTGTTCAGCTAGACGCGCTTTGCTACAATTGGGGAGGCAGCATCGATCTCGGATCCAAACCAGAAA
CCATGACTGCCATGTACCAAGCGATCGAAAATGGCTTGTGGAAAAAGGACGCATTTCTCTTGGGGAAGATACAGACAGAG
AATGAGCTTCAGTCGGCTTCACCGAAAACAATGGAGCGCATGATGGAAAGAGAGATTGGGTTTCTGGAGAGCCTTGCCTT
TTCAGGATTGTGTAGCGATACCATCGAGTTCGAGACGAGGATTTCAAGCACAATACTACACAACACCGATGATCCAAAAA
ATGGCAACCCACCCGACAAGATTCTACCCCGTCTCTCATTCCTAAGAACATCAGACCCGCCAGACTCGACGTCAGGAAGC
CAACAATCCTGCCACTTTTTGCACTTGATTTACCAGGAGTACTTTGCGGCACGGTACTTTGTGCGGAAATGGAAGTCTGG
AGAGGACCTCGAGCCGTTTACGATCACCGATAAGAGCGGAAGCAAGCGATGTGTTCGCGGCAAAGGAATTGGCACAACTA
TATTTCTTCACCAACACAAGGCCCGGTACGACATACTTTGGCGTTTTGTCGCCGGCTTGCTTGACTCCGGCGATGGGCAT
TCGGACGAACAAGACACACTTAGGTTCTTCCAGACCATCGATGAGAAACCGCGCGATCTTTTGGGGCCCGCACACCAACG
GCTACTCATGCATTGCTTGGGTGAGGTGTCGCCGAACCTGTTGATTCGGCCAACACTAGAAAAGAATTTGACATCGTGGC
TTTTGTTTGAGAGCAGTTTTGAGAATGCCTCCCTCGCACGGGAAGTGGAACTTCCGGACAACGTTCTTATGGCTGCTTTA
GAAGATGGCAGCAACAAGTACAACATCGCAGTATCGCTGAACGGTAGACCAACAATCCCGTCAAGCATCGTCAAATTAGC
AACGTCATGGCTGGCTGATGACTACAACGATAAGGCCGCTCTTCAAATATTGGACAATTCTCACATAAAGTTGCCAAACA
TAACGCTACAAGCGCTGGTACCACGACTAGAAAACGGAGATGTACTGTCAACTCTCGAGATTTTTGGAAGAAACTCGCCA
TTGCCAGAGACAATTATCCCAAAGATTGAGGCGAAACTAGATGCAGACTCTACTGTTGCGTCAAAGGCATCTTCTATATT
GTCAGCTCAGCCGAACTTAACGAAGAAGGCAATACTTAATCAAGAGTTCCAGTTAAAGAGCAAATTGCTATTGGAAGCGG
AAATTCAAAAGCTTAGGGTGTCACTTGAGGATAACTCCCTGTTGGTCAGGTACTCCGCAGTCACGGCCTTAGCAACACAG
CCAGCCCTCCCAGAAGAAATAGTTCAAAAACTCGCTACGCTACTTACAGACGATTACAGTTCTATTAGACACGCCGCAGC
TGAGGCCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62