GenePrediction:GLEAN_7123 Details

Name: GLEAN_7123
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4098907..4097463 (- strand)
Length: 1445
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4098907..4098702 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_140:4098590..4097743 (- strand)
Length: 848
Type: CDS
Source: GLEAN
Position: GCSC_140:4097506..4097463 (- strand)
Length: 44
>GLEAN_7123 class=GenePrediction position=GCSC_140:4098907..4097463 (- strand)
ATGTTGGCCCCAATCGACTTCGTATCCCCCCACACCGCCATCTTCCTCTTCTTGACTCTGCCTATCGCTGCACTATGTCT
CGTTGTTCGAAGTACCCTTGGGGGACATCGGTCCCGCCGGATACTACCGTCCACGTCGCTGGAGAGTCTGGGCATGGACA
TGGACAAGGAGGTCGTGGGCCCCGAATCCGCTCTGCCACGCGGCTGGTGGACCGATAACTCGGTCTTCCAGCTCGAGCGA
CGCGCTGTCTTCAGCAAGGCAAGAATTTTGGCGTCTCCACCCCTGCACTGATGAAAGGACACCCTGGCTTATTCAAGGCC
GCAGACCTGGATTTGTGTCGGCCACCGTGGCCGCTTTGTCAAGTCGGGCGACTATCTCGCCCTCGATCTTGCTGGCTTTC
GCATCTTCCTGATCCTCAGCAAGGATGGCGTCGTGCGTGCGTTCCACAACGTCTGTCGCCACCGTGCCTTTCCCATCACC
CGCAAGACGTCCGGAACCTCGACCGTCCTCGCCTGCCAGTATCACGGCTGGACCTACAACACGCTGGGCCAGCTGACTAA
TGCACCTCACTTTGATCAGCTGCCGGGTTTTGCCAAATCGCCAAACGGTTTGTTCGCCATCCACACAAAGACGGACAGTC
GCGGCTTTGTTCATGTCAACTTGAGCGGTAGTCTCGAGGCAGGAGACAGCAAGGTCGAGGACGCCGAGATCACCGGCCGA
CCGGTCCACATCAACGGGTGCGCCCGGCTCATCTACAGCTGGGAAGGCAAGGGGCAGTTCAACTGGAAGATTGTGGGCGG
AGCGAGTCCTCGGGCGACATTTGTTAACGTGCCGGCCAGAGGCCTCCTCGCCCAGGCCCTCGCAGCATGTGGCCTGGTTT
CTACAACTACCGGCCAGCTGCAGTTCTTTCCACTTACGACAGTGCACACAAAAGTGGGCAGCCCTTTCTGGTACCAAATT
GTCTACTCGCCCGAATCTCCTCAGAAAACTACTGTGCGATGCGATGTCTACACCACTCAGAAGACGGATCCTTTGTGGCG
CTTTGAGGATGAGGCAAAATTTCATCTTGAAAACCACCTGCAACTTATGCTAAAAAGTTATGAGAACACATACTCTGAAC
TCAGCAACTTTGTTCCCAATTCGCCCAGGGACGGCAGAAGTCTTTGTAAGCCTCCCTGTCTTCTTCAATCCACAATGCAT
GTGGTTTTCTGACAAAAAGTATAGGTGTCAATACACGACTCGCTGAAATCGTTAAGGTGCATCAGAATTTGGAGCATATT
GAAGGACGCGAAATACAACCAGCGGCCGTAAAGCAATGTCACAGCGCTGCTTTCACCCAGACCGAGAGTAGTATGCCACA
GGGATCCCTTTCACTCCTTCGATGACTAACTAACCGTGTAGTATGTCAAGCTATAACGTGTACCAACACCAAGTTAGAAT
GGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62