GenePrediction:GLEAN_7125 Details

Name: GLEAN_7125
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4077021..4076059 (- strand)
Length: 963
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4077021..4076941 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_140:4076617..4076151 (- strand)
Length: 467
Type: CDS
Source: GLEAN
Position: GCSC_140:4076077..4076059 (- strand)
Length: 19
>GLEAN_7125 class=GenePrediction position=GCSC_140:4077021..4076059 (- strand)
ATGGTCAAATTCAAGCCCAACGATGCGGACTATGACAGTGTCCTCGAAAGACTTCAAGGTGTTGCTCAGCGAGCACTGAG
AGTGAAGGGGCACATTCGAGTGAAAACTGCATGTATGTAACAGCGACGAATCAGGGTAGCCTTATAACATTCATTAACAG
AATCAAGTCTTGGTTCCGCATACCAAGAACCCAGACTATGTTCCGAGAACCAATATTCTAGACAGCCTCAGACAACAGTT
TGGCCTTAGTTGTCCAGAGGATGGAGAAAGGCCAAGTAAGAGAGTGGCAATCTACGGTCCCAGTGGGTCACGCAAAAGAA
TAGCAATCTACGGGCTCGGTGGTGTTGGGTAAGTCTTCCTGGTATCACTCAATATGCAGCTAACACCGCAACAGGAAAAC
GCAGATTGTATTGGCCTTTGTATATTGGCTCCACGACTCGCACCCTAATGTGCCAGTTTTCTGGGTTCATGCCAGCAGCG
CAGACAATTTTCGTAAGGACTACGCCGCCATTGCAACGCAATACAAGATTCCCGGACACGACGACCCGAAGACAAACATT
CTATCGCTCGTCAAAACCTGGCTAGAGACAAGGCTTCAAGCCCAGTGGTTGATGGTGATCGACAACGCAGACGACCTGGA
GCTGTTCTACCAGCACCAACCTATGGAAGTTTCGACAGGAACGACCTCACAGCAATCCAACGAAGAAATCAAACTGGCTG
GATATATCCCGAAATGCGACCATGGATTGATCCTGATCACAACAAGAGACAGGAAACTTGCAGTAGATCTGGTCCCTCAA
CAGTCCCCCGTCGAGATACACCACATGACCCAGGAAGAGGCTCACCTCTTTATGTGCAAAATCTTGGACAAGTATGAAAA
AACATCTGAAGACATACATGCTCTTTGTTCGAAGCTGGAATATCTACCCCTCGCCATTTCACAGGCGGCAGCGTATCTCC
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62