GenePrediction:GLEAN_7129 Details

Name: GLEAN_7129
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4060505..4058865 (- strand)
Length: 1641
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4060505..4060183 (- strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_140:4060119..4060037 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_140:4059963..4059691 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_140:4059603..4058985 (- strand)
Length: 619
Type: CDS
Source: GLEAN
Position: GCSC_140:4058913..4058865 (- strand)
Length: 49
>GLEAN_7129 class=GenePrediction position=GCSC_140:4060505..4058865 (- strand)
ATGTCTAGCCTGCCCGAGGCGAACGAAGGGGAGACAGCCAGGGTGGGTGGAGCAGCGCAAAGAGGAAAAATCACGAACAC
GGCAGCCGCAGCAGCAGAAGCAGCCGCAGCCGAGTGTCCGGGGAAGGATGCCGGCAGCTTCGCACACCCGGCGTCGTTGG
AGCCGGTCATCAGCGACGGGGTGTCGTCCGTCTTCAGCACAGGACTGAGCGTGAGCCAAAACACGCAGCCCTCGCAGCAG
CCTCTGCCTTCTTGCCTTGCGCTGACTGAGGAGACGCAGGTCGACGACGATGCCGATTCGGCCGTGGGCGACATTGAAGC
GCCGTAAGGAAGCCCTGCGCCCGCCTGCCCTGACCAGGCCTGACTAGACCTGAGCTGACCGTCTAGATCGTCGACGCAGT
CCGTGCGGGCGAGCCTCTACGAGTTTGTCGAGGAGAACGGCCGGACGTTCCACAAATACAAGCAAGGGAGTGAGTCAGGC
CGTGCTACGACGTAATAAGGGGGCTTCTGGTGGGGAAGAAACACCGGCTGACCAGGCTGCAGAATACCTTATGCCAAACG
ACGAGGTGAGTCGGCCGTTGCGGGTGCCGGGTTGTGCGACGTCGGGCTATGCTAATGCAGACAGAGCGAGCAAGAACGGT
TGGGTGAGTGTGCGTCTTTCTGGTGTGCGTCTGCCAGCTGCTGACAGATCTGCAGACCTGCAGCATGCGATTTTCCTGTT
GTTGCTCAAGGGACAGCTGGCGCGGGCGCCCATTGATGAGCCGAAGCGGGTGTTGGATGTGGGCACGGGAACGGGCATCT
GGGCGATTGAGTTTGGTGGGTTTTTCTTTCTTTTTTTCTTCTCTCTTTTCTTCTCTTCCTTTCTTCTTTCTTCCTTTCTG
CTCACCCCTGCTGACGTTCCAGCCGCACTTCATCCCGGCTCTGACGTGCTCGGCACCGACCTGAGCCCGATCCAGCCGGC
CTTCGTGCCGCCCAACTGCCGGTTCGAGATTGACGATGCCGACGACGAATGGGCCTACAGCAGCGCGCCCTTTGACTATG
TGCACATGCGGCTGCTCTGGCACTCCTTCTCGGACCCGCACCGCGTATTGCGCTCAGCCCTCGACAGTCTCGCGCCCGGC
GGCTATCTCGAGTGGCAAGACTTCCAGGGCCGCTTCCGCGCCGTCGACGACAGCCTCCAGGGCCGGGCGCTCTCGCGGCT
CGACGGGCTCTACGTCAAGGCCGGCGCTGCGCTCGGTCGCGACATGATGCTGACGCCCAAGATCGCCGGCTTGATGCGCG
AGGTCGGCTTCGTCGACGTCGTCGAGGAGAAGTACGCCCTGCCCGGCAACACCTGGCCCAAGGGCCGCGAAGCCAAGACG
CTCGGCCTCTGGCAGCAGACCAACTTCCTCGAGGGCATGTCGGCCATCACCATGACCGTGCTCACCCGCGGCCTTGGCAT
GTCCGTCGCCGAGGTCGAGCTGCTCCTCATGGAGGCCCGCAAGGACGTCAAGGATACGGCCGTCCACTTCTACATGCCCG
TGTACGTTGACGTGCTTACCGTGTGTGTATACCGTGTTTTGACTGTGTGCTGACTGTGTGTCGTCGTCCTAGTTACGTCA
TCTATGGCCGCAAACCTTTCCCGCATGAGGTCCGGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62