GenePrediction:GLEAN_7130 Details

Name: GLEAN_7130
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4055837..4051485 (- strand)
Length: 4353
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4055837..4055659 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_140:4055037..4054513 (- strand)
Length: 525
Type: CDS
Source: GLEAN
Position: GCSC_140:4054415..4053832 (- strand)
Length: 584
Type: CDS
Source: GLEAN
Position: GCSC_140:4053754..4053104 (- strand)
Length: 651
Type: CDS
Source: GLEAN
Position: GCSC_140:4053016..4051485 (- strand)
Length: 1532
>GLEAN_7130 class=GenePrediction position=GCSC_140:4055837..4051485 (- strand)
ATGCGACTTCTCGAGATTCGCGCAGGAGGGTTCAGTCTAACCCACGACCTGTCGTCTGACAACCTCCCTCCGTACGCCAT
CCTGTCACACACCTGGGGCCTGCTTGCAGATGAGGTCATGTACGAAGATATCGTGGAAGGCAGGGATAAGACCAATCCGA
AGCTTGAGTTTTGCAGACAGTATGCGATGCGAGATGGCCTACAGTTTTTCTGGATCGATACGTGCTGTATTGACATGTCG
AACCTGGCCGAGCGCTCCGAGGCCTCCGTGTCCATGTTCCAATGGTTCCAGAAGGCAGCTCGTTGTTACGTCTATTTGTC
TGATGTGTCTACCGCGACCGGTGACGGTCAGCTGTCCGATTGGGATACGAGCTTTCGCAACAGCCGCTGGTTTACCAGGG
CCTGGACACTACAGGAATTGCTCGCTCCGTCATCAGTGGAGTTCTTTTCTCGTGAGGGCGTCCGTCTTGGCGACAAGTCG
ACTCTCAAACAGCAAATATATGAAATTTCAGGAATAGCTATGACGGCGATCGAGGGCAGAAACCTCTTGGACTTCAGTTT
TGAGGAAATAATTCGGTGTGCAAAGTCTCGTGAATCAACTCTCGAAGAAGATAAAATATACTGTCTCTTCGGCATATTTG
GAGTGTCTTTGCCAGTCATTTATGGCGAGGGCCTAGCCAATGCAGAAAGGAGACTACGAGAGGAAATAAAATACGCTAGT
AGCTCTTTGGAAGCCATTATAGGGCTAGCTCATCCGGATACATCAACCAACACGGCAAACCTATCAGCAGCTCTAAAAAG
TCGGGGCCGGCTGGATGAGGCTGAAACAATGGATGGGCAGGTAGTGGAGGATAACAAGATGGCATTCTGGGCCGATCGTC
CTGACACACCGGCCAGGGTGGCCGATCTAGCGTTAACGCACAAGAGCGAGAGAGAGGTGGACGAGGTTAGGTGGCTGGAG
GGAGAGGCGGTAGAGACACGGAAGACCAACTTATCTGATTCAGGCTATGGTACAGCTTCGTACTGCACCAATCGGCTACC
TTATGGACTCGGCGCACTCGACTCCATCCGAGAGGAATTTGACGACAAAGCCACAATCTACTCAGATACCTCGAGCCGGA
CTGACGCCAGATTCGAAATTTATAGCACTATGCTCGCGGATAACCTGGCCGAAATACTTGGTCCATCCGCCCTCGATGAG
GAGGTTCTGAACAGCGCTGTGAAATCTCTCCCAGACCTCCTACAGACATTAGCTCTAAAGTTGGGCTTCCAAGCACCGTC
GAAGATGCATCGCGATGCCATGGTTTTCATTCATAAGAACCGAAAGTAAGAATCCTACCCTTTTGCAAAGACTCTACGCG
GCTCTTTTGTAACAGCCATTGCACAACAGTTCGATAGCGCATTCTTTTCGACAGACTATCAGTGCCCGCGAGGATCTGCC
CGACGATCTGACAGCTGGCTTAAGAGAAACAGTGACCACAGAAATCTTTGACAGGTTCCTACGAGCCTCTGACGAAGAGT
TTGATCCCGTCCCTGAGCCTGTCGTTGACGAATCAGGCTTGACTGCAGACGTAGACGAAGACCTGCATTCTGACGAATAT
AGAAGTTTGATATTTGACGATCCGGGCTACGAATGGCTTTTGCAATGTCTACGAAACAGTGTCCTCCTTGCACGGCCAGT
TCCAGACAACCTGCAAACAATACACGAAGCCATTCTCAAGGCGATCCCGACGCCCAATCACATGAGTCGGAGGACATCAT
CAAAGGGATGCTCAGTGACATATACGGTAGATTGGGATCCCTTTGCTTTCCTCGATGCCCAGGAGTACGAAGAACCCGAT
TATGAAGTTGTGGCCAAAGTTATTACCGTGACAGGACACTGCAGGGACGCCCAGGCACTTAGCGTTCAGGATTATCTTTC
TCAGACGTGGCCATCATCGGGACCAGGTTTTCTCCGCCTTATTCAGACCGTGGTTAGAAACCGTGGCCTAGACATGATGT
CTGAGGGTAAGTGTAGCCTCCGTTTACCCTATGTAATGAATTAGCAATCTCTAACCGAGGGCTGTTTACCCTTTCCGGTC
TAGATCAAGTTTCAAATGGTACAGAACTCTCGGCTTCCTACGAGCACCATACTGGATTACGTATTACGGCTTCAGGAGTT
CCAGGATTCGTCGCAGAGATAGGAGAGCAGCTTGCATGGCTCGGTGCTGCGCTCCGGTTACCAGATCCCGAGCTGCCAGT
ACCCACAAGCTTGATCCGCTGCGTTCCATTTGTCGACACGATTATACATCTTGGAAACGAAAGTGGACGTGATAAAATAT
CATGTTCCATTCGATTTCTACTTAAAGAGTCCAAGGACGCTTCTACTCAGGACAAAGGGCAGTGTTGGTATGGCCTGTTT
CAGAGACCTCTTTTCGTCGAGGGATTCCCGGTTTCCCGCCGACCAAAAGCCGATACTGGCCTGGAAATTCCTCTCGACAT
GGCAGCTGCTCTCGTTGGTGCTCGTACAGTCGAGATCTTCAATCGAAACGTCTTTATCAAAGGGTTATCGGCGATGCTGG
TGCCTACTGAAAAACTCGGCGATACAATTGTCTGGCATCTTATCCGAAATCAACGACCAAATGAGCGAATCTCATATTTG
GACTGTGGCCTACAGCACAAAAACGCTTATCTCGCCGAGATGGACAGAGCTCGACATATTGTTGGCTGGTGCTCCGAAGC
AGACTGCGACGTTGGTAAGTGCCTTCATTTCCCCGTCGAATTGCCGAACAAGTTTCATATTCTCTAATCTTTGCTTCTAA
ACTAAAAATACTTTGTGGTAGGCAAAAAGAGAGCCAATTACTCGATTAAGAAGTCTGGACTCCCCAAACCGCACACTGGC
TGTGTTTTGGAACACATTGAAGTTCAAGGCGGTCAATATATCATGGCGACAGGTGCATTTGCTATTGGCAAGCGCCAACC
CGCTGCCTATATGACCCGAAAGGGTTACATGCTTAAAATGGACTGGATTTCTTCCAGATACATAATCCTCTGGGACGAGA
AAGAGAAGAGAGGATGGCTGGTGAACGGTGCTAGGGCCTTGCTGCACCTTCTTCGAGCATCACTAAGACACAGCAAGGAT
AAATTCGGGTCCGCATTTCTCTTGGATCCAGATGACCTCACGGATGTCGACTGCACGATGGATTCAGAGTCAGCACTCGA
TATTCTTTTGGATGAAAATATACGAACACGTCCGCTGTATGTAGACAAGTACGAGACTACCTACGAGGAGAAACGCCAGC
CTACAGTTCCAGGACGGGCCATGCTAGATGTCGAAGGGGGGATAAATAAGGTTAAGCAGTACCATTTACTGGAGGACCAT
ATCGAGCACATCTTCAGGAAGTTGGAAAAGCTGGTCGACCACCAAGCCCAGATCGAAGGACAAAGTGGGCTCAGAATTGA
CCCCCGTCCGAGAAGGCAGCTAGAGGGCTGGGATTTTTGGGACCTGGCCACGGAGAGCGATCCAATCTTCCCCAAAGTGT
CTACACTAGACACGATTGGAAAGGGCTGGGTGGACTTTTCACGGACCATCCGCGCCGTCTGCCTATTTGGCAAGGGATTC
GGTGACCTGATCAAGCCCCGGCAAGCAGCAGCATCTGCGACGGCATCGACGGTCCTCTGCCCTCGCTGGAGCCTGCTACC
TGCCCAGAGATCATACCTTGCTGTCTGTGTGACAGACATTCGGAAGATTATCGATGACTACGGCGACATCGATGCCAGCC
CCGTGCGCATCTGCGACTCGGTCCTTTGGCACATGAAGCAGACCGCATTCCGGGCGTGTCCCTGCACGAATTCCAGCGAC
AGCCTGGCTTCAAGACACGATCATCATGACCCTGTGCAGGTGCTGTTCCCAAGGAGCTTCAACACGAGGCTAAAGGCGAA
ACCGCGGGTCTGTCTAGAAGATCAAAAACAAGGGGCTGTAATTTTTGGCCACAACCTGAATCTGCGCTGGTACTGGAGAG
ACCATGGTGACCCTGTTAATGACATGTCACTGCTACAACCGCCTGCACTCACTATTTCCTCTCCTAGCGATAGTGACAGC
GTTGGTAACGTTGGGCTGAGCTCAGAGTCAAGCAGTCAACCGGGGTCGAATCTTTTGGAACTGTCATCGACAGCCAGCGG
TGTGGACAATCACGGGATACGGGATACGCAGTCTTCTAGTGCTACTTCTATAACAGTGTCGTCACAAGATGGCCAGGAAA
ACGCATCAAAGGAAAATGAAGATGGTGGCGGAACGGGGCAGAGGGGCCTCAAACGGCTATTCCGAGACTTGGGGCCGTCT
AAATTATCTGTGCATAAAAGAAGGAGACCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62