GenePrediction:GLEAN_7131 Details

Name: GLEAN_7131
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4047909..4046190 (- strand)
Length: 1720
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4047909..4047883 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_140:4047752..4046304 (- strand)
Length: 1449
Type: CDS
Source: GLEAN
Position: GCSC_140:4046246..4046190 (- strand)
Length: 57
>GLEAN_7131 class=GenePrediction position=GCSC_140:4047909..4046190 (- strand)
ATGGGCTCCTGTTACGGCATGGAAACGGTATAAGGGAAATCGGTCTGGCACGTCAAAAAAACAGAAAATCTCTTCCGAAA
CCAGCCCAGACTCCATACCTTGTTTTCCACTGCTGTGGTCTGCCTATCCTGACCTGTCCCTTCACCGCGCACAACAGAAG
AACCCTGCCATTGCGGTTCCCGGTTCCCCCTCCTTCTGCATAAGTCTTGCCATGATGACGCACGACCGCATTGAGGCAGC
GCCAGTCCGCCACGGAGACGACAGCAAGGACGAGAAGCTGGGTGAGGGCGCGGGTCCGACGTGGCACAGCAGCTCCGAGG
AGGTTGTCGGCGAGATCCAGGAGCTGTCGGCGAAGCAGCAGGCCGACCTGGAGAAGCAGCGGGCGATCGAGGGCGACGAG
CGATTCCACCGGCTGGGCTGGAAGCGTCTCACGATCGTGCTGCTGGTCGAGGCCATTGCGCTGGGCGCGCTCAGCGTGCC
CTCGGCCTTTGCTACGCTGGGCCTGGTCCCGGGCACCATCGTTTGCGTCGGCCTCGGCTTCATCGCCATCTACACATCCT
ACATTGTCGGCCAGGTGAAGCTGCGGTACCCGCACGTGTCGCACTATGCCGACGCCGGCCGCCTGTTGATGGGCCGATTT
GGCTATGAGCTGGTCGGCGCCATGTTCGTGCTCCAGCTCGTCTTTCTCGTCGGCTCGCACTGCCTCACAGGTGCCATCGC
CTTCAACAACATCACCGACGATGCCATCTGCTCCGTTATCTTCGGCTTCATCTCTGCCGTCATCCTGCTGGTGCTGGCCA
TCCCGCCGTCCTTCTCAGAGGTGGCCCTGCTCGGCTATGTCGACTTTGTCTCCATCGTCCTCGCCATCGGCATCACCATC
ATCGCCACCGGCATCGACTACACCAATGCGGGACAAGTGGCGCTGACTAAGCAGCCCTACCAGCTGTGGCCGGCCGACCA
CCTTTCGCTCGCCGACGCCTTTATCGCGCTCGGCAACATCATCTTCGCCTACAGCTTTGCCGTCTGCCAGTTCTCCTTCA
TGGACGAGATGCACACGCCCGAGGACTTCCCCAAGGCCATCTGGGCCCTCGGCATCATCGAGATCATCATCTACACCCTC
ACCGGCGCCCTCATCTACGTCTTCGTCGGCCAGGACGTGCAGGCGCCCGCCTTGCTCTCGGCCGGAAAAACCGTGTCCAA
GGTCGCCTTTGGCGTAGCCCTACCTGTCATCTTCATCTCTGGCGCCATCAACACTACTGTCGCCGCACGCTACATCCACG
GACGCGTGTTTGAGAAGTCCGTCATTCGTTACATCAACACCAAGATGGGTTGGATCACCTGGCTGGCGCTTATCACTGTC
ATCACCATCATCGCCTGGATCGTCGCTGAGGCTATCCCCTTCTTCTCTGACCTGCTCTCAATCTGCTCATGCCTTTTCAT
CTCTGGATTTACCTTTTACTTCCCCGCCGCCTTCTGGTTCAAGCTGCTTAAGGAAGGCCACTGGTATGAGCGCAAGAACA
TTGTCAAGAGTATTGTCAATGGCATCATCTTCATCATCGGCATGATTGTGCTGGGTGTAGGCACCTATGCTAGCGTTACC
GACATTGTAAGTATTCGTGCTCGCTTTTTATCATACTGTGTCACGTGCTAACCCCTTGGTCAGAACAATGGGTACAAGAA
TGGAACTGTCCGTGGAGCGTTCAGCTGCAAGGCATCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62