GenePrediction:GLEAN_7132 Details

Name: GLEAN_7132
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4042793..4041760 (- strand)
Length: 1034
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4042793..4042721 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_140:4042660..4042560 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_140:4042495..4042012 (- strand)
Length: 484
Type: CDS
Source: GLEAN
Position: GCSC_140:4041965..4041760 (- strand)
Length: 206
>GLEAN_7132 class=GenePrediction position=GCSC_140:4042793..4041760 (- strand)
ATGGCGTCAATTGAGATTAGTCAGCTATTCACAGTCCAGGACCTTGTGGCTGTCGTGACGGGCGGAGGATCTGGTGAGGC
TTTTCCATATAACCTGTATACATATGGCTACTGACTGGTATCTCGGCATGCAGGAATCGGTCTGATGATGGCCCAAGCCT
TAGAAGCCAACGGGGCCACTGTTTACATCTTTGGTCGTCGCCGAGAGACGCTCGAAAAGGCAGCAAGCACAGCAGTAATA
TACTTTCCCTCTTTCTTGTCTTTCTTCGCTCCCCCGACCACCTATTGCTAATCGTCAGAAACACGCCAACATCTTTCCCA
TCGTCGGTGACGTCACCAGCAAGGCCGATCTTGAGCGGGCGGCCGCCGAGGTCGAAGCTGCACACGGCCACGTCGACATT
GTCATCGCCAATGCGGGTATCGGCGGTCCGGGAATGGTTGAGCTTCCAGCGAACGCGACGCTGGACCAGTTCCGCCAACA
CATTTCGACCTGGACGGCCGAGGCGTTCACGCAGACGTTTGCAGTCAACACGACGGCCGTCTTCAACACGGCCGCTGCCT
TTCTCGGCCTGTTGGACGCGGCCAATAAGCGAAATGGCAACCGGGCCCCGTCCCCCAAAAAGAGCCAAATCGTGGCCGTG
AGCAGCATCAGTGCTTTCTACCGGCAGCCGGTGCACGGGTATGCCTACAGCGCGTCCAAGGCGGCCGTGGTACACATGAT
GAAGCAGCTGGCGACATCGCTGGTTCCGTATGGCATCCGGGCCAACGTGATCGCGCCGGGATGTAAGTGAGAGCAAGAAA
ACGGCGGTGATGTACGCTAACAAAATAGTGTATCCCAGCGAGCTGACCGTCGGCGCCCTGGACGCCTACAAAGACGGCTG
GCCCAAGACACTCATTCCCGAAGAACGGCCTGGCGAGCTGCAGGACATGGCCGGCGCCATTCTCTTCCTCGCCAGCCGGG
CTGGGGCCTACATCAATGGCAACGTGCTCGTGACGGATGGCGGAAGGCTTAGCGTCCTTCCGGCGTCGTATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62