GenePrediction:GLEAN_7133 Details

Name: GLEAN_7133
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4041396..4040027 (- strand)
Length: 1370
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4041396..4041206 (- strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_140:4041148..4041107 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_140:4041046..4040980 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_140:4040922..4040882 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:4040816..4040753 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_140:4040673..4040323 (- strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_140:4040257..4040027 (- strand)
Length: 231
>GLEAN_7133 class=GenePrediction position=GCSC_140:4041396..4040027 (- strand)
ATGGCCACAAGCCCAGCCCAAGAAAATGCGCCAGTGTTGGCACCCGATGTGGGCGATCCCCAAGACGGCGATTCCACGCT
GGGGGATGAACAGTCCTTCCTATCGAGTGACTCCCTCGCGAGTAGCATCCTGCGGTATCGCGAGATCAATGGGCGGACGT
ACCACAACTTGCGCGGTCCAGGAAACTATTAGTTCGTTTGCCACGTTGATTTAATACATTTGCCGGCATCTGGTACTGAC
TCACGTAGCGGTGCAAACGACGAGAAGCAGAAAAACACGATTGATCTCCAGTGAGTCTGACCTTGTGCTGTGTCATACTT
CCTGCTTTTGGCCTCTATTCTAAGAACAAGACACCACGTTCTCACACTCGCCCTGGAAGGGAAGCTTCATCTGGCGCCGC
TGCCGGATACAGTAGGGGTTAGCAACATCTGAGGACTGCCACGGCAAAGACGCAAGACTGACTCGCTCGTGTAGAAAGTT
GTCGACGTCGGCACCGGAACGGGAATTTGGGCAATGTGAGTAGAGCTCGTGCATGTTCTTTCTTAGCCCGAATCGACAGG
GAAGCTAATGCTGGCTTTAGCGATTTCGGCGATGCGCATCCCGAGGCAACAGTCACCGGATTTGACCTCTCGCCAATACA
GCCTGTATGGGTTCCCCCAAATGTGCACTTGTGAGTGATTCTCTCTCCGTCTTGCAAGCCTTCTTGCGCACGGCTGACGT
CAGAGCCTGGTCGATGACTTTCTTCTCGACTGGACCTTTGAGGAAAACTCACTCGACTTTGTCTACATGCGCTGGCTCGT
TGGTTGCGTGCCTGACTGGGCCGAGCTTTGCAAGAATGCATACCGCTGTCTGAAGCCAGGTGGCTGGATCGAGTCGTTTG
ACTCCAACGGCTACTACCTGTCGGATGACGGATCGGTCAAAGAGGGAACGGCCATTTTCCAGTACGGCGAGTTCTTCCGC
TTGGGCGCCGAGAAGATAGGCCTGAAGGCATCTTTCCACGTCGTCCGGGATGAACTGCAGCGAAAGGGCATGGAAGCAGC
AGGATTTGTCAACATCCACGAAAAGAATATCAAGGTAGGCAGCTCGGAATCTGTTTCCGCTGCGGCTCGCCGAAATGCTA
ACGGGGTCGAATGCTGCAGGTGCCTGGCTCCGAGTGGCCGCGTGATCCGAAGCAGAAGGAAATCGGCATGTTTGCCCAGG
CGGCAGTGGACGATATCGAGGGCCTGGTCAGCCTCATGGCGACCGAGTTAGGATGGACCCCGGCCGAGATCACCGTCATG
GCCGCGAAGATGCGCCGAGAGCTACGCGACCCAAACATACACCCACACTACGTCTCGAAAGCAGTCTGGGCCCAGAAGCC
GGTCGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62