GenePrediction:GLEAN_7134 Details

Name: GLEAN_7134
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4034912..4033178 (- strand)
Length: 1735
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4034912..4034883 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:4034657..4034486 (- strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_140:4034420..4033971 (- strand)
Length: 450
Type: CDS
Source: GLEAN
Position: GCSC_140:4033866..4033508 (- strand)
Length: 359
Type: CDS
Source: GLEAN
Position: GCSC_140:4033297..4033178 (- strand)
Length: 120
>GLEAN_7134 class=GenePrediction position=GCSC_140:4034912..4033178 (- strand)
ATGTTGTCGCCGCCGATTGCTAGGATATTGGTAAGAACCCTCTTCCAGTTTTTGTTTTGCCTGTCTATCCCCATAAGAAC
ATAAATTGACGAACACAAGATTGTGATTTTTGTAGCTCTTGGGAGCATGGCATATGGTTACAGTTCGAGTATAATCGCAA
CCACCCTTGCCCAGCCGTCGTTCATCACCTACTTCGAACTTGCTACTCGTTCCAATGCAGTACAGCTAGTAGGTGCCGTT
AACGGCCTCTTTCAGACAGGTAGCCTGTTTGGTTGCTTGTCCTGTATCAAGTCCGCGGATCTCCCTGGGCGCAAGAGAGC
CATATTAGTCGCCTCCCTTTTCGCTATCGTCGGAGGCGCGCTTCAAGCAGGAAGCGTCGATGTCGGCATGTACCTCTTCT
CTCGCTTCGTGACAGGGCTTGGAGCGGGTAAGTGTCTTCGTCTTCCTATGGCTACGCTGGTGTGCCTGCCCCCAGTCTTA
CCGTACATTCAGGATCGCTGGTCGTTCTCGTTCCCCTGTACCAATCCGAGATTGCCCCGCCTCGTATCCGTGGTCTTCTC
GTGGGCATGCATGGTGTTATGATCTGCGTTGGGTATGCCCTTGCCAGCTGGATCGGCCTCGGCTTCTATTTTGTCAATGC
ATCCGGCGCCCAATGGCGACTTCCTCTAGCCATCCAGTGTCTAGCTCCGCTGTTGCTAGCCATGGGAGTCTCCTTTCTCC
CCGAGTCTCCTCGCTGGTTGCTCGACCAAGACCGCTACGTGGATGCACTGAGTTCTTTCGAAGCTGTCCGCGCCGAGTCG
GACGACTCGATCATTCACAACCGTGAGGCCATTTGGCCGAATTTGAACTTCTCCGGGCACATGTCCAGCAGGAAACGTCT
ATGGGACACCGTTTTCGGGATCTTTTCCAATCTCCGTCTATGCGCAGACGCTGCCTTGTTGGGTTCGTCATCTTGTTTGG
CCGCCAGGCTACAGGCACAACTGTGATCAACAGTAAGAAAGACTACCTTGTATTCGCACTTTTCATACTATCTGACTTGC
TTTTAGACTACGGGTCTAGTCTCTACGAGGCGCTCGATTTCTCCGTTGTATCGCAACTTCTCATTCAATGTGGCTGGGTT
ACGGTCTGCCCTGTGGGAAATCTGATCAATTCCTTGCTAGTTGACCGAGTTGGACGCACTCGGCTGCTTTCAATCGGCTT
TTCGGGCATCATTGTCGCTCTGATTGGAGAATGCATCGCCGTCAGCCGCTTCCAGAGTACAGGTTCAAGGGCAATGGCCA
GCCTTGCCGTCTTCTTTCTCTTTATGCACATTGCCTGTTTCTCCACCACTTCAGACGCGACCTCTTACATCTATGCATCC
GAAATCTTTCCGACAGCCCTCCGTGCCAAGGGCTTGGCAGTCTCTGTGTCTGGGCTGTTCGTGGAAACAATCATTTACCT
TCAATGTGCTTTCACAGCCTTCAATGCGATCGGGTGGAAGTACTACATTGTTTTCATCGCCTGCTCTTCGGTCGTGTTCT
GTTTTATATGGATTTGCTGCCCGGAGGTGATTTTTCACGCAAAAAATAGTTTCATTGATACATTCGTTTCATTCTAACAC
AACCCCGATTCCTAGACTCGCCAGCAGTCGCTCGAAGACATCGGTGGTCTATTCGGAGATAAGGCTGATCTGGACGAGAA
TGAGAAGGCTACCGAAGTCAGGACTGAGTACATGGTCCCGAGGATACCGCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62