GenePrediction:GLEAN_7135 Details

Name: GLEAN_7135
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4027525..4019619 (- strand)
Length: 7907
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4027525..4026646 (- strand)
Length: 880
Type: CDS
Source: GLEAN
Position: GCSC_140:4026566..4026379 (- strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_140:4025205..4025143 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_140:4025074..4024796 (- strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_140:4024732..4024603 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_140:4024549..4019828 (- strand)
Length: 4722
Type: CDS
Source: GLEAN
Position: GCSC_140:4019746..4019619 (- strand)
Length: 128
>GLEAN_7135 class=GenePrediction position=GCSC_140:4027525..4019619 (- strand)
ATGGCGTTAACATATAACAAGACCTTTTCTCTCACCCTTGTGCCGGATGGCGGCACTGTGAAAACCGATATCAATACATC
ACTCGGTGATATTGTGGGCTCTACGTTCACAGTCGACTTTCAGACTTTGTACGAGGTGCATGGCGGCTATGACCCAGGAG
ATAAAGATAACGCAAGTCTTCTCGTGATCAAAATTATTCCCATGCCCCGGGATGTCAATAAGCAGTTCTCCAACTTCACT
GTCAGCCTTTCTGTCGAGGCCTTCGCTGGTGAAGAAGATAGTAAAGTGCATGTGGTGTCCTTCGAGCCGGCCTCTTTGGG
GTCAGAATACGTTGGTGTCTATACAAAAGATCACGAGCGCCAGCGTGTGGCTCAGCTTAGCGGCCAGGTGCCCATAATGG
CGACAGCCGCCGCCGGTATTCAGTTATCGTCCACGGATACAACCAAATATTCCACGACACACCAACTCTCTGTCACAGGC
ACCGCGGACCGATCAGATTGCTACCCATACATTGACGTGAAAAACCGTGTCTCCTGGCAAGTTCGAGCGGCAAGCCAGGA
GCAGGGCATCGGAGACTCCTTGACCGTCGCAATTCTGGTCAAGCGGCCTTGCAATGCAAAATTCCAGCTCGTTGGCCAGG
TGGAAGGGAGGGTAGGGGGCGTCTCTGCAGCCACAAGGAGGTTTCTCGGCAAGCTAGCCCCCTATCGCCGGGATCCGAAG
ATATTGGCCATCTTTCCGCTCGACCGGCGGAACACACCAATGCCCCCCGATGTTTTGGCCGACAACCTGCATCGAGCATC
GACGGGAAATGCCTTGCGTCGCCTGACCGAGGTTGGTGTGCATCTTGCCGAGAAGACCGAGCCTGTGAAGTTGCTCCGAG
GTAATCCCTCACCCCTGCATGCTTGTGATCGATGGAGAGCCGAGTGTGGCTGACAACAAGCCATCATGGCTTCTGGCAGA
ATTGCCGGCCTCGTCCACACATCTGCCTAGTGCAGAAAGCGAAGAAACGTCGGTTAACAGCACCATTCCAGAAAAGGAAG
AAGAGCGGACACACAGTGCAGATTCTTCCGTTGTCCCCTCCAAAGAAACCATTTTGACGGCTGCAACACACGTCTCCACA
ACTACCACTGACACGGCTGAGGCTCCCGTAGAGGCAAATGTTGCTGCATTATTGGCTGATATCGTGCAGCGGCTAAACAC
CCTGACAGCCGACTTTCGGCACAGGGCGCCAAGTTCGTGGTCGGATCAGGGTGTGTCAGACTCAGCACACCACCTTGTCT
CGATGACTCGGGTTTCGCGTCACCGAAAAATGGCTGCCTTGTACGAACAGCTTGCGGAGATGCACCGCGACGAGGCAAGA
GATCTTCTATCTCTGTAGTCGGCAGCGTATCAAGTCGCTGGGAGGTGGGGTAACCTGCGTAATATTGTACCATGTCCCGT
GTCAGCAGGTCAATATAATATTGCGCTTTTTCCGTTCTGCCTTTCTCATTGGCTCAATCGAAGAAGATGGCTGTGTGATG
TTCCAGTGAGGCTGAAAGTGATTTATGCCGTCCGGGTTCAGAACCCTTGTTCAACACCACTTTTCGTAATCTTGCCCGTT
CTTAACACGGCCTTCGGACTTCGCTAGAAGGGACGAAAACCAGCCGGTATGGTATTCCTGGATCGTATCTTTCCCTGAAT
ATTTCACACCACAACGGTCTTCACATCACTCACTTTGCAAAAAACCAAAGCCGAGTTCAAAGACCAGAGCTGAGAACAGT
CGACCTGACCATGGGAAAAATGTCCGAAAGAGTGTCTACAAATTCTCAAGGAGGACTTAGTCTCGTCCAGCTTACCGGAA
TAAAAACCAATGTGTCTGAAATTGGTTTCCTCACAACGTGAGTATGATCTTGGTGCCCCGTAGAATGTATCGATCCTGTC
TGCTAATCTTACAGAATCGTTGTGGTTCACGGCCTTGAGAGTACAGACAACTCGGCCACAGCTTGGACATGGCGAAAAGA
GGGAGTTAACAGCCCAATTGCGCAGTTGGCAAAGTTTCTCCCATCGCATGGTCGGCGGCCACGCGTATTCTCCTGTCAAT
ACTCTTTAGGACAGGAACGGGAGCGTGGAATTTCCACTGCCCAGATTGGAAAAATTGCAACAGAAATTTTGGACGGGCTT
GTATGCCACGACGACGAGAATTCTGATAACAGCTCGCTCAAAAAGGAGTTCGTCTTCATAGGCCACGATATCGGTGGGCT
AATTATTAAAGAGGCAAGGCATCCAACCCCACACAGAACTGGATGCCATCGCGGCCGACTAACTCACGTTTTTGCTACAG
GCACTTTCTTTGGCCAAGATAGCAGCAAAGTATAATGATATATCTGGAAACACGACCCTAACGGTAAGAAATGCTATCAT
GTTCGGATCTGTGTTCAACGAGGATTATGACCCTGATGTACTATCTCCAAGGTTCTGTATGAAACGCCGACCTGGCCGAC
GCAAGACATGTCGTGGGAGGCGCTGGCCAACCGGCTCATGCTCGTCCCTGGGAGAGACGAGTTCTTTACTCTGTCGTGGC
TGCATACAACGGCAGAAATGATCGAAGTCGTTTGTACAAAGTTCGCCAGCAGCGAGAAACTGTATAGAACCATCTGTGTC
CCCAGCTCAATTGAGACCAGCCCAGATGCGACGGCCAAGGAAAGAGAGAAGAAGGAAGAAAACAAAACCCTAGGAAGTTG
TATCAGACCGGTCCGTTTGCACCTTGCTGTCTTTACGTTCCATAAAGTTAGTCTGCTAAATAATATGATGCAGTTGCTGC
GCTCAATGTCCTTTCGCCCAGACGTGGACACCCAGGATGAAAACAATGAAAACGTCGACATGATCTCCCGTGAAGAAGAG
CTCTTACTAAAGCGCATCTTCCGGGTGATGATTGCACCATCCAGTATGTTCAAGGTTACGCAACGCGTATAGCTCTGATT
TTGACCGTCTATGCAGATCCTGGCACGCGACTGATCAAATGTCTCCAAACATTGATGCCCGCCCATATGCATCAGCATGA
GACACCCTCTCCACGTTTCGGCAGCAGCGCGGATGAGAAGGTGTGCAGCATTCTCGATGATAATCCCCACTTTCGGAATT
GGCAGGAACGCAATCACGGATCACTCAAGATCGTCATGCTCGAAGAAGACGACTCATCTTTGGTGTTTGCGAAACTGCAT
GAGACACAGAATACAGTGGGCTGTGAAAGAAAAAGCCTGGCTATTCTTGACTACGTCTTTGACAATCAAAGGTGCAAACA
AAGCAGCGGCTCCGATATGCTGGCATCGCTCTGCTATCAAATACTTTGCCTCAAGCCGAGGCTTTTTGAACACGTCGATT
CATTGGTGGAACATATCTTCAACCAGGGAATGAGCCGAGAAAACCGCCACTTCATCCTACTCCAGTCCCTCTTGAGCTGC
CCGGAACATGGGAATACGGTTTGCATTATCAGAGCACTGCCCGACACGACAATTCCGTCAGAGGCGCTAGCTCGGCTTTT
CACACTGGCCTCTCAGGAAGACCGTACACTCAAATTGGTCACCGTCAGTAATGCCGGTACTTTTGGTCTTCCCGAATGTC
CAACGGTCTACTTGCAGCAGGAGACAATTGATTTTGGCACCATTGCGGACGAGGAGCTGGGTGCTTTGATGAGGAAGCAA
TTCGCCTTTCGAGACAATCCCAGCATGATTTTGCGAGACGGGCTAATAAGACACTACGAGAAAGAGCCCATACTATTTTC
CGGGACCCCGGAAGGGACTGGGGAAGTCATACGTGCTTGGGTTGAACTGGCAATACGTATCGCGAGGCCTATCTCGGCGG
CCTCTTTGAAGAAATCGATGCCGTTGATTCCCAATAAAAAAGAAGAGATTTATAGAGACATATTGGGACAGACGCCATCA
GCTGACCGAGATTTGCTGCGACAAGTGTTGCCATGGATGGCATTGGCTCAGGCTCCTCTTGGCATAGCTGAAATTTCTGC
AGCTCTGGCTATAGAAAATGGAGCTTCGTCGATGAACGAAATGCGCGAGAATATGCCTATCAATCTGCTCGGAGACATTG
AGAGCTCCCTAGGCTGTATCGTCCGCACAACAAAGTTGAAAGTTCCGACATTACCCAGAGCATTCAGAGACTTTTTGACA
ACAAAACAAGGCCACGGCAGCGACAAGGAGGAAGGTGGCACGTTGTCGGCAAGCATTTGTGCAGGCGGAGATATGCAACT
AGCACAGACGTGTCTGGAATTTCTGAGTCTTCACAGAGATCAAGACCCTTCAAGTCTTGCAAACGCTGCGGATCAGCACC
CTCTGCTCAAATATGCGACACAGCACTGGCCGGAGCACTACGCCAACGGCAGAATGGCTTTAATCAAAGAGCAGGAGACA
TATGATATGCCACCCGGAATCGCTCGTCTATTCCACAATGGAGAGCTGATCACATTCTGGGCACGGTTGTATAGCTACCT
CGAAAACTCCGGGGTCGAATGTGGTCCGATAAGTGCTCTTGGCATTGCGTCAGAAGTCGGATGCATAGACCTCGTCGACA
TTCTTCTCCGAGAGGAGCTCACCACAGAGGATATTTCAAGCAGCCTCTTCGCCGCCATACGCAGAGGTGACGTGGAATTG
CTGGATCGCATTATGGAGGCAACAGATGATACTTCAGCATGCCTTCATGGGGTAGCCGTTTATGGAAAAGAACAGCTGTT
GCATCGATTCAAGGCTTCGGCTGTGGAGAAAGATCACCTCAATGCAAAAGACCGCCACGGCTTCTCGCCGCTGCACCACG
CTTGCATGGGAGGCATGCTCGAGATTGTCAAAGAACTGCTCGACAGAGGCGCGGAGACGAACACCCCCGGAGGTCCTCGA
GACGTAACACCACTGCACTGTGCCTGTTTTTGTGGCCACGATGCTGTGATCGGATGTCTAGGACGGTGGCCCGGCGTGGA
CGTGAATGCGACAGACACGTGGGGGCAGACACCTTTGCACCACGCCTGCAAAGGACAACAGCCGGATGCGGTACGGGCTC
TGCTCAGATTCCCGGCAGTAGATATCAGCGCAGTCAGTGAAGAGAAAAAGGAAACCGCGTTGCTTCTTGCTGCCACTGCG
GGAAGAACTGACATCATTGACCTTCTTCTACCAGCGTATGGAGAAATCAATATGGCGAAGGAACTATCCGCCCAGGACGG
TTTGGGCTGCACAGCTCTACATTGTGCTGCTAAGGGAGGTCATCTTGGAGCGGTCAAGAAATTACTGCGTTGCAATGTAT
CGCAGGACAGAATTGTCAGTGTGGGAGACAATGCGGGTAACTGGCCCATCCACCTAGCATCGAAATTTGGCCATACCGAA
GTGGTGCAAGTTCTTCTCGAAGAGGCCGACAACTCCAAGCAAATCGAGAGTCTTGAGGATGATGACATGACGCCGCTTCA
CAAGGCCGTCCTCTCAAATCACAAGGACGTGGTTGCGCTTTTACTGGAGCATCATGAGAAGAAAAAAGTGCCCTTGGACG
TTTCCGATTGGTACTCCAGATGCAGTCTGCATTACGCTGCCTCACTCGGCTACGACGATATCACCCGACTTCTGGTCAAA
GGAGGGGCGACACTGGATGTTGTGGATGAGGACGGTGAAACGCCTCTTCTGAAGGCGTGCAAATCTGGACACGACGCCGT
TGTGGACTATCTAGTTGCCGAAGGAGCCGATGTAACACTTGAGAGCCAACACGGCCTCACGCCTTTGCTCGCAGCCGCGA
TGGGCGGCAGCAAAACAATCATGGGTCGCATCGCGTCTTGCAGGAACGTGTCGCTGACTACAAAGGACGCACGGGGCCGC
AATGCACTGCACCATGCCGCTTCAAGTGGCAATGAGGCTTCTGTATCTTATGCCTTGACACTCAAGATCGACCCTGCCGA
GAAGGATGCAGGTGGTAGGACGGCCTTGTCAATCGCAGCAGGTAGCGGCCATCTCGAAGTTGTCAGACGGGTCGTCCAGA
GTACTCCGACTGGCATGGAAGGTGCAGATAACGGCGGGAACACGCCCCTTTTCTATGCTTCAAGCAACGGGCATCTAGGC
GTTGTTGCGTTCTTGTTAGACAACACACGCGATTTGGATCTTATGAACAAAGAAAACAAAGGACCTTTGCACGCTGCAGT
TCTAGCAAACCATGAAGAAATCGTCAAGTATCTGTTACAGGCCGGAGCTTGCCCAAACACGAAAGTAACCGGTACACTGT
CGACACCTCTTCACTTTGCTGTGGTCCACGCAGGACCAGCTATCGTCGAGTGTTTGGCCAGAGCAGATGGAGTGGAAGGA
GAGGTTCTGGACAGCGAAGGAGTGACGCCAATTTTTAAGGCTGCCCTGTATGGGAAATCTGACGCGGTCAGCAAACTCAT
CGATGCCAACTGGCACGGCAACTTTAAACAAGGAAAATGGATGTGGTACCCTCTCCATGCGGCGTACCAAAACACAGAAG
CCATTGAGCAGCTTGTTACCAGAGCACAAATGTCTCTCAGTAGCCCCGATACAGACGGCGATACCGTTCTTCATCTCGCT
ACTCAATGGGCGCCACAGTCCGTTTCTCTGCTTCTAAAGCTCGGCTCAGATCCTCTTTTGAAGAACAAGTCGTGTTCTAC
GCCTTTGCATCTAGCTGCAAAACGTTGTGACGTGGACGTTTTCACCATGATTCTCGACAAAGCGAAAGAAATGCACCCCG
AAGAGATGGCATGTATGGAGAACCTACGGGATAACATGGATCATACTGTGCTTCTATCAGCAGTGAGTTCTGGGATGACA
CCCACAATACAGCTTTTGTTGAATAGTGGGAGGTTCGATTTAAATGACAGGGACTCATCCGGGGACTCTGCCTTGAACCT
CGCGGCCAAGGCCGGTAAGCCGGAGGTGATAGACACATTGCTAGACAAGAAACCGGATGCCTGGGACCCAACCTGTCTTC
GGCGAGCCTTGCTGGCTCTGAAACCGTCAGACGGGGATAGGTCACAGCACGTCGCGTGCAGGATGGTCCAGCTGCTGTCG
AACGTAACCGCTGCAGAGAATAAGCCGGAAAAGTTCTGGGCCGACGATCTGCTTCTCAAAGACGCCATGAGCGAGAACAA
TACCTTCCTCATCCGCCTGTTTTTACACGAGAGGGGGGACGATCTGGCAGGCTGGAAAGACATTCATGGCTGGACGCCTG
TGGAAGTTTTGGAGGCGTTTGATGAAGATACTCAGGACATGGCCGCAAGATCATCCACAGATGGAGACGGCCAAGCGCTG
CCATCGGAATGGGATCTGCAAAACAGCAGTCCCAATTGTGTTGTCATCCATGGGCCGAGCGAGCAGGCCGAGACGGCCGT
GCAGGTGAAGTCGGAGGCGACTGGCGACCAGTTCAGTGTCATGTTCGGGAACCACCCAGTACCGCACAAAACAACGTTTG
CGTTTTCGGTAGAAGTTGTGCGACTCGGGAAAAGTTATGTTGGCGTTGGTGTTGGCCACAGAGGCGGCCCGCTCAATATA
ATGCCGGGCTGGACTGACGACACATGGGGTATGCATAGCGACGATGGCAACTTATACAACAGCGGAAGAGTCTTCCGCAA
AGAGCTAGGAGCCACTTACGGTACCGGTGACATCATCACGGTCTTTGTCGACACACTCGAAGGAACAATGTCATTCCTGA
AGAATGGCGAGCTCATAGGTCAGTGTGGTGGCAGCGACATGCTCGTTCTACCAAGGTTTATCTACCCACTAACGACTACT
CTATACACTGTATCTTTAGATCCCATCTTTACCAACATCCATGGCCGCGTCTATCCCATGGTTGCTATTGGACCAGGCGC
CGAGATTAAGGCCGTCTTCACAGGCATATCTGGGATAGATGATCCATATAACGATGCCGATGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62