GenePrediction:GLEAN_7137 Details

Name: GLEAN_7137
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4014927..4010766 (- strand)
Length: 4162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4014927..4014902 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_140:4014564..4014177 (- strand)
Length: 388
Type: CDS
Source: GLEAN
Position: GCSC_140:4014109..4013816 (- strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_140:4013756..4013576 (- strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_140:4013509..4013477 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_140:4013412..4012110 (- strand)
Length: 1303
Type: CDS
Source: GLEAN
Position: GCSC_140:4012032..4011655 (- strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_140:4011534..4010766 (- strand)
Length: 769
>GLEAN_7137 class=GenePrediction position=GCSC_140:4014927..4010766 (- strand)
ATGCAACGACAAAGACGCCTCATCTAGTCCCCGATTTAGCTTAAAACTCAGGCGGCGAGCCAGCTTAGTCGATTCAGCGG
TCTTGCGGAACCAAGTCCGCACTTTGCGAGAAGTACTACAATGGCAAGTGGGCCGAGTGGGATAACACGGGATGCAGCCG
CCGGGAGCGACCGCGAGAATCAAAGTACAGCAAATAGCTCTCTTCCAGCTGGTTCTGTCGTGCGAGATCAGGGTTTTACT
GTTCTTTCCGAGGGCGATGCGCCCATTGTTGAGTCTGTTGCCTCCCAGTCCCTTTTTTATTGTACATTTCGTATGCCTCC
CCTTCTCTCCCCTGCCTGGCTAATGTGAACTCTACCATTGCAGTCTGGTTTTTATCCATGGCATCCAAGGCCATCCACAT
AAGACCTGGGCCACCCCCTCTGTTGACCCGTCGAAAACCACGGGCCGCAACGTTTTGTCGCTTCTGAATCGCCGGTCGAA
ACAAGTCGGCTCCGATGGCTGCCTCACCGTCGTGGCGGACTCAGTCTTCTGGCCCAAGGATTTTCTCGCTGCCGACTGTA
GAAACGCCCGCATTCTCACGTACGGATACGATTCCCGCGTTACGCACTTTTTCGGGGGGGCACCCAACCAGAACAACATC
AGCGCCCATGGCCGATCGCTGCTCAACGCTCTCGAGCGCAACCGGCGCGAGTCGCCCAAGCGGCCCGTCATATTCATCGT
CCACAGCTTGGGCGGCATCGTGTTAAAAGAGGTGGGTCTACTGTCCTTTAACTTAGGAGCGTACTGGTTTTTACCAACTC
GTTCCCTTGTGTGTCCAGGCTCTCCGTCGGTCCAAAGCAGCTCGCCTAGAGGACCAGGATCTTCGCGACATGTACGAGTG
CACCTATGCTATTGTCTTCTTCGGAACGCCCCATCGTGGGAGTTCCTACGCCAAGATTGGCCTCGTTGCCGAGCGTATTG
TGAAAACCGTCGGCTTCGCTGCGAATGACAAGCTCCTAAGAGACCTTAAGCCTGACGGCACGCATCTCGAAATTTTGAGG
GAGGATTTCTCTACCATGCTCGAGGACCGAGCCTTCAAGGTTTATTCTTTCCAGGAGGGCCAGGGCTTGTACGTAAACCA
TATGATGAGGCCGTGGTAGACCAGACAACAGACATGCTGAATCAAAATTAGGTGGTCGACGATGCATCGTCTAGCTTGGA
CAGCCAGATGGAGCGAAAGGACCATATCAATGCGAACCACATGATGATGTGCAGATTTCTCAGTCGAGAGGACGAGGGAT
ACATAAAGTGTCACGGCGTCATAGCCAAATACGTGCAGGAAATCGAGAGGGGCGCGGAGGCAACACAGCAAGGTGCGTAG
GGTTGCTACATGTCGCCTCCCGGACAGCAGAGTGGAATTTGTATCTGATTCTAGCCAGAGCTCGACGAAAAGCAGAAGGC
ACTGCGAGAATGTAAGACTCAACCCGTCCCCTCCGTGAGTCATGTCTGTTCGCTCACCATACGCTCTCCCGCCAGTGATA
CTCCAGAGCCTTAGTACCGCCGCCATGGAAGACCGGCATAGACAAATCGAGAGCGCACACTCGGACACGTTTGATTGGAT
CTTTACCGGCCCAAACGCAGGATTTAAGAGCTGGGCAGAGAGTGACCACGGCATTTTTTGGATCAAGGGCAAGCCCGGGT
CGGGAAAGTCGACGCTCATAAAGTACATCCTGAACGATCCTCGCACACTCCAGTATCTGTCCTCTCGCGACCGCAAGGTT
CTCTCCATGCCTTCCTTCTTCTTCCACGACCGCGGCGAGGACATGCAGAAGTCGTTTGACGGCCTCCTGCGCTCTGTCCT
CTATCAGCTGGTCTACAACATCCCGGCGCTGACACACACCATATCCAAGTTCTACTACCAACAGATGGAGAGATCTGGTG
TGTGCACCTGGCCGGCGCCAGAACTCGAGAGCTCTCTGCAGGCCGTGCTTGCACAGCAAAGTGTCCAGGGCTGCGTTTGC
CTCTTTGTCGACGCCCTTGACGAATTCAAGGGGCGCAAAGACAAGATCACGCGTTTTCTCAAGGCCCTAGCCGCGCCAAA
ATCAGGCCAGAGGCTTACCATCCGCATCTGCGCATCGGGGCGTGATTGGAACGAGTTCCTTATGCTGAGCGACAACCCGC
ACATCAGGCTGCAGGACTGGACGGTTGGCGATATCCAGTCGTTCGCCCAAGACCGACTCGCCGAGGCGCGAAGAGAGGAC
ACGAACCTTTTACTAAAAGAGATCACCGAGCGCGCCGAGGGCGTCTTCCTATGGGTCAAGCTAGTTGTCGACGAACTGTG
GGAGCCGCTGATCAACGGCCTCCCCATTAGCGACCTTGTCGCACTCATGGGCGACCTGCCGGACGAGCTCCCGCTCTTTT
ACGAGCGCATTCTGTCCAACATACCCCAGCGAGACCACGCAATGTCACTGTGCATGTTCGAGCTGGTCCTGTCGCCGTTG
AGCCACAGACTCAGCCTGAGCGATTTCTCGCTGGCCGTCGAGCTCATACATTCCACTTCCACGCTGCCGCAGGATGTGGA
TTTGGAGAGTGCCGGAGACCGAAAGCGGTGCGACCTTGTACAGAGGCGTGTCAGGGCCTGTTCGGGCGGCCTCCTTGATG
TAACATTAATGACATCCGTGCTCCAGGTTCAGTTCATCCACCAAACTGCACAGTCCTTTGTGCGCGATGCGGAAAACAGG
GCATGGTTTGACGGCAAGTCGGCCTCGGATCTTGCTCTTGCCGGTGCAGAGCGGATCATGAGGCTCGTTGTTCAGCTACT
TGGTCATACGGACAAAACGTAAACAGTCTCCGTTCCTGCCCCTCTCATATTTGATTATTTTATAGATTGTGCTGTTGCTG
ATCCTCACCTTGCAGTCCGCAGTTGTCTTATTTCCGCCATTGGTCCTTATCAACCCTAGAACTGCTCAAGAGTAACCTCC
ATTCGAGCCTTATTAGCGAGTTTGTCGACCAAGCTCTCGGGTGCCAGAACATATCTAGACTTCCAAGTCAAGCCGTTATG
GACGAATTCCGCGATTCCATAGCCGAGCATTGTGGGCCTAAATGGCTGGAGACGTACTGGAGTATAGCTACTAAACACGA
TTGGATTTATTTCTTCCAAACAATATTTAACAGCCTGGTGCCGGCTTTGTTTCTCGAGTTCATGGTAATTAGCGGACTGC
TCCAGGTCGCCGAGCGCGAGTTGACACAGAACCAGAGCCGGGGCCTCACTAATGCAGAGAGCACCAGACTTTGGTATTTT
GTAATTTTAGGAAATCACCAGACAACAATAAGCCACCCTAGCCAGCTAAGGCCAGGCATCAGTTATCGGCAGTGGAAAAA
CTTTGCGCGGATGATTTCTAAGAACGGCTGCAGTCCCCGCGGAACCGTTTCCCTCAACATTGCAAACGATGTGGGACGCC
TGATGACCCAGTTTCGACTACCACACCCGCCCAGAAGCAGCGACAGAGATAGCAGTAGCAGCACGAGAGTTTCTGGGAAG
AGTGCTGTGATAATGGTGGATATCACGCCTCTGCACATGGCTCTGGCGGTCGCGTGCACCTACGATGCGGACAATGTCCT
GGGCCGAATTTTCAAAGTGGAGATGGTCCGCATACTCGTGGAATGTGGAGCAGACGCGACAGCCAAGTATCAGAACGTCT
GGAGCGCACCGAGGGACCACACAGAGAGGACCGCGGTCCATTATCTGCTCTACAAGGATCCGGATGAGAAGAATCCGTTC
GACGACCGGGATCTAGGCGACGCACTGTCGAAGTGCATCGTCTCTTTCTTCGATCACGGCCTGGATCCCAACGCCGTGGA
CAGCAATGGCAAAAGCATTCTCGAGTACGCAATCCCTTGGTGCCCAGCGAGCCTTATTGAGATTCTGCTCCAGAGAGGCG
CAAAAATAACACCAGGCCTGCTCACCGAGACGGGCGAGTTGATCCCTGCGGCCTCGGATATTCTCCGCAAGCCCGAGTGG
CGGCGACCAGAATTCTACACCCCCGAAGCCAACCGCCTTGTGCAGAAGCACAATCCTGCCTGGGAGCAGGACAGCCCCAT
GGGGTTAGTGCAAGGAGTCGGAACCTTTTCCTTTGCGGCGAGAGCTGTAGCCGGCCTGGCAGCATCATTTTGGAACTTTT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62