GenePrediction:GLEAN_7138 Details

Name: GLEAN_7138
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4006069..4004151 (- strand)
Length: 1919
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4006069..4005640 (- strand)
Length: 430
Type: CDS
Source: GLEAN
Position: GCSC_140:4005505..4005424 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_140:4005369..4005141 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_140:4004744..4004289 (- strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_140:4004201..4004151 (- strand)
Length: 51
>GLEAN_7138 class=GenePrediction position=GCSC_140:4006069..4004151 (- strand)
ATGGCTTTAGATCCAACTACATACGACCGGTTGTACATAAACGGCGAATATATACGGTCCAAATCCGACAAGACGCTATC
GCTACGCAGCCCTAAGAATGGCAGCCTCATTTCTGATGTCGTGCCCTTGGCTGGCTCGGGCGATGTCGACGCCGCCGTGC
ACCACGCTGAAGCTGCCTTTGCTGGTCCCTGGAGCCGGGTCTCGGCAGCCGAGCGGAGCGTCTGTCTGCTGCGGCTGGCC
GGTCTGCTCAAGACTCGTCTACCGGACATCCTAGCTCTCGACCGGCTTACGACCAACAAGACCGGCACAATCCGAAGCAG
TCTACTGCAGCTGGCCGGCTGGTTGAAGAATCAGCCCATAAGCAGAATGTGGGCGTCGCTACTCTTCACGGATGACAAGG
AGAAGGTCTGGAGCTGTCTGCAACACTATGGTACGTTGATGACGTAGCGATTAGGTGGCCGTGCAAGGATGGTCCAATGC
CTGCATTGCGTCTGCTTCTTTCTGCACAGTGCTGTTATGTTGGTAGTTACAAAGTGCTCTTGATCGACACAACTAACAGC
GCAGCCGGCTTAACCGACAAGCAGAAAGACAGCTTCTCCCTTGCCGATGATGGCCACGTCAAGCTCGTGCGACACGATCC
GCTAGGGTAGGTTTGCTGCATCTAAAACGGTTCACCAACTCTGATTAACAACACCTATAGTGTCTGCGTCGCCCTCAACG
ACCACAGTTCGCCCATCGTCTCCTTTATGGAAATGGCCGTCCCCTGCCTGGTCACGGGGAACGTGCTGATCGTGAAGCCG
CCAGAGAAGTCGCCGCTGGGGTCCTTGGCTATTGCACCGCTCTTTGAGCAGGCCGGGTTCCCTCGCGGCGTCGTCCAGGT
CCTTACCGGTGATGACTTCACCAGGGACCTGCTCTCAAGCCATACGCGCGTCCGTCATATAAGCTTTGCTGACAGCTGGG
CTACTAAGAAGAGCCGGAATCGGGCGGTTTCGAGTAGCCCGAAGCAGGTGACATTGCGGCTAGATAGGGCCTCTCTTTGG
TTTTCTTTGATGCATCACTTCCTTTATGTTCTCAATCATGCCGGATTTGTCCCGTTTTGTTCGTTTGTGGCATCTTTTCT
TAATATGATCATTCGCACGGTGGCCGTTATGCTCATTTTAATTTCCGCTGTTGGTGTCTTTCCTCCATTCGCCATTACCG
TTGTTCCTATAGTCTCCATCTTAACTTTTGGTCTGACTGTCATCTCTTTCGGCATTTCGTTTTTCAGTTTCTCACTCCAT
TTTGTCGGATTATCGTCAAAGCTCTACCGCTTACTAGCATTGCAGAATGTTTTGGCAAAGTATCGCATCTTTCGATACTT
TTATTCCTCATCGTCTCCTTCAGTTTCGCCAAGTGGGACATGCCCGGCCATCATTTGTCGCGATGCCGACATGGAGAACG
CACTGGCCTGGACTGTCGACAGTATTTTTGCCGGACAGGGCCAGGTTGTCACCAGAACTGCCCTCTACATTCATAGGGCC
ATCGCAGCCGACTTTCTCGAGGCCTACACGCAGCGCATAAATGCCGCTACTGACCGCCTCAAAATACAACCAGCCGATTT
TGCTGAATCACAGCCACACATCCAGATCGTCACCTTTGAGAGCGAAGACGGGGTCATGCAGCGAGTGAATGACTCTGATC
ACGGCATCATAGCCAGCGTCTTTACCAGAGATGCAGCCCGGGGCATACAGTTCTCGTCCCGCATCGACGCCCGTGTGGTA
GGCATCAACTGTATTAGAACGGTTAGTCAATTTTATTGTTTTATTTCCTCTTCCTCCTTTTTATTCCGTACCTCGTGCTA
ACCCTTCAGACAAACCTACGAGTGTCAGTTAGCAAGAAGCCCTCAACTATCATTGTTTATGATTACAGGGAACAGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62