GenePrediction:GLEAN_7141 Details

Name: GLEAN_7141
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3980762..3979776 (- strand)
Length: 987
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3980762..3980633 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_140:3980583..3980508 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_140:3980433..3979776 (- strand)
Length: 658
>GLEAN_7141 class=GenePrediction position=GCSC_140:3980762..3979776 (- strand)
ATGAGAACCGACCTTTTCCTCGCCGTGGCCTATGCTGCCATTGTCAAGGCATCGTCCGACTACGACCTGACCCTCTTCAG
CGAGGCAGGCTACAAGGGAGAGGCAATTCAGGCCGAGCCCAACCAGTGCAGTAAGTGTCCATCGACTTTAGATCGCGAAA
ACAAAGCTAACAGTTCCAGTGTCTTTCAGCAAGCACAACATCACCCGCGCCAAGTCGGTCGCTCTGGCCGGCAACCATGC
CTGCATGTTTTTCTCGTAAGTCGACGCACTCAGCGTCATAACTCTCGGCACAAGCTACGACAGACGGACTGATAACATGT
CTATCACAGGTCGAGCTCCTGTGACCGCATGGACCTGGCGCAGCCGATCATGGGCGACGTGCCCAACACGGACGTCTGGG
GTTTTCCCTACGGCCCGCGCGCGGTCAAGTGTCTGTCGAGCAGCGCGACAGACGTGCTCAAGAACTACGACTGTACGTTC
AACGCGTGGTGCAGCGTGCTCGAAAAGCAGGGCCTCTGCCCGTTTGACAGCAGCTGCACGCAGTACAATCCGATCGAGTT
CCAGGACTGGCAGCGCTTCACAGAGCCGGGCGTCAGCCCGGTCATCGACCGCTACCTCGTCAACAGCACGACTGCAGCGC
TGAACCGGCCCAAGGAGGAGCTCAAGGCAGCCCGGCCGGCCAAGATCGAGGTCGACAGCCGCAAGAACTGGGAGGGCGGC
TCGGACGACTACAGCGCCAACTGGATACCGCCGGCCCACCCAGACCCCGAGTCCAAGGCGGAGGCCAAGGCCATGGCCAA
GGAGGCCCACAAGCAGGCCAAGCAGGACCGCAAGCAGGACCGCAAGGACGCTCGGCGCAAGAACAAGGAGCAGAAGGCCT
ACGAGAAGGCCCTGTTCGAGAAGGCTGAGAAGGCTCGGAAAGAGAAAAAGGCCAAGGCCAAGGCCAAGGCCAAGGCGGTC
GAGCGCATCCGCAATGGCGGCCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62