GenePrediction:GLEAN_7142 Details

Name: GLEAN_7142
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3979445..3978360 (- strand)
Length: 1086
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3979445..3979128 (- strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_140:3979062..3978681 (- strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_140:3978577..3978360 (- strand)
Length: 218
>GLEAN_7142 class=GenePrediction position=GCSC_140:3979445..3978360 (- strand)
ATGTCTCTGCAGGCAGCCTCTCTCTTTCGCGTGGACGGCCTCGTAGCTGTCATCACGGGCGGTGGATCGGGTCTGGGCCT
GACGATGGCGCGGGCTCTGGCCCTAAACGGAGCCCAGCGGGTGTTTGTGCTGGGCCGCCGGCGGGCAGTTCTGGACGCTG
CAGTGGCCGAGGTGAATGCAGAAGCAGAAGAAGCATGTCGGGCGAGTGGGAGCGTGTCGGACGGGCCGCTGGTGGCCATC
GTCTGCGATGTGACGGACAAGACATCGCTGCAGGCAGCCGTGAACGTCGTGACGGCCGATCCGGTGGCTGGTGGCCGCGT
GAATCTCTGCTGGTGGCCAATGCTGGCGTCACGGGTCCTCCTGGCCACCTGTACGGTCCCCAGCCGGTCGACAATGCGGC
ACTGCGTCGCCGGCTCTTTGACGATGTCGCCATGGCCGATGTCACGGCCATCTTCCACGTCAACGTGACGGCGGCCCTCT
TCACCATGTACGCCTTCCTCGAGCTGCTCGATGCCGGCAATCGCAGCGCTGTGGCCTGTGGGACATATGGCGCACCCGCT
GGCCCGCCGTCCATGACCAACCCGCGCGCCCATCCACGCATCCAGAGCCAGGTCGTGTTCACGTCCAGCATCGCCGGCTA
CACGCGCAGCAGCCTGTCGGCACCGGCGTATGTCGGCAGCAAGGCGGCCGTGCTGCAGCTGGCCAAGCAGGCAGCCGGCG
TGCTGGCACCGTATGCGATTCGGGTAAACGCGCTGGCACCAGGAAGTAAGTAGGGACTTTTTTTTCCTTTTTTTTTTTTT
CCTCCATATCTCTGTCTCTCTCTTTTGGCTTCTCCCTGTTTCTTTCGCCTCCATCAGCTAACCGTCAGTCTTCCCCTCGG
AACTGACTTCCGAGATGATCGTCAACCGCCAGCCCGAAGACGAACCGCTCGACCATCCCGGCTTCCAGCCAGCCCGCAGG
TTTGGCTGCGACAGCGACATGGCCGGCACCATCCTCTACCTGGCCAGCCCTGCCGGCTCGTTTTGCAATGGACTGGTACT
GCTCGTCGACGGCGGCCGCACCGGCGTCCTTCCGGCTAGTTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62