GenePrediction:GLEAN_7143 Details

Name: GLEAN_7143
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3977286..3972544 (- strand)
Length: 4743
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3977286..3977257 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:3977047..3975970 (- strand)
Length: 1078
Type: CDS
Source: GLEAN
Position: GCSC_140:3975909..3975834 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_140:3975781..3973556 (- strand)
Length: 2226
Type: CDS
Source: GLEAN
Position: GCSC_140:3973497..3973330 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_140:3972817..3972544 (- strand)
Length: 274
>GLEAN_7143 class=GenePrediction position=GCSC_140:3977286..3972544 (- strand)
ATGCAGTCCAGGATCCACTGGAAGCTTGTCGTTTCTTAGGGCTGAAAGACCACTTCTCGGCCACACGGAGTGCCGTTAGA
GACGAGGGTGGAGAGGCATCGGTGAATGCTGGTCTCGACCAGCTCTCTCAACCGTATAAAAGGTGAGCAGCCGGCCGACT
ACTGCCCGTTCATCTGCCTTGTCTACAGGCTGTTGCTGTTGTTCCTAGTGCTCTAACCTGACTTCTGCTCTCTTCCCAGT
CATACGACTCGGTGTCTGCTCCCTTCTTCAGCACAAACCTGCCCTTCCTGCACCCCCAAGTCCTCGCCATGGGCTCTATC
GACGCTCCCGACTACGGCCGTCGCCTGCTTGTGCAGGTCGTCGATGACGTCGCCCGCAACGACCCCACGCGCGAGCTCGC
CTTGTTTCCGCGACCCGGCTGTTCCGATCGTCTGGCCTCGCCCGAGTCCTGGCAGCACGTCAGTTTTGCCCAAGCCGCCC
GGGCCATTGACCGCCTCGCACACGCCGTCACGGCCGCGGTGGGCTCGGGCTGGGTGAAGCCCCAAGTGGACCTCTCTGGC
CTGATCGGGCCCACTCTGGCCTACATCGGCCCCAGTGACCTCCGGTACCATCTCTTTCTGTTGGCCGTCAGCAAGGCCGG
CGGTCAGGTCCTGCTGATCTCGCCCCGCAACACCGTCGAGGGCCAGGTGAGCCTGTTTGCCAGCACGGGCTGTCGGGCCC
TCTGGGCACCGGCGACGTCGCGCTCGCTGGTCGAGTCGTGGCCGGCCCAGACGCCCGGCGGCCTCGCGCTCTTTACAATG
CCCGAGCTGGACGCGCTGCTGGCCGACGACGACGATGCGGCCGCCCAAGGTGCTGGCTTCTCCCGCGACCCGTTCCCCTT
CCACAGGACCTTTGACGAGGCCGCGACCGAAGCCCTGGTGATCCTGCACACCAGCGGCACCACCGGCCTGCCCAAGCCCA
TCGTCATCCGCCATGGAATGTGGGCCAACTTTGACACCTTCCAGGGTGTCGCCGACGAGAGCGGGCCGACGTTGATCTGG
TACGCCTGGAAGAAGCACATCACGCACTTGTTCGTCACCTTGCCGCCCTTCCACACCGGCGGCATGTCCTTCTCCCTCGT
GATGAGCATCTACCTAGGCATCACTGTCATCTTACCGCCCACGGACCGGCCTGTGAGCAGCATCCTGGTCGAGGACGTGC
TCACACACTCTGCCGCCGACGGCGCCATCATACCACCCTTTACGCTGGAGGAGCTCGCCAAGACAGCCAGTGGCGATGCT
GCCCTCCAGAAGACGAAATTCATCATCTGTGGTGGCGGTACGTCGTCCCTGCTTCTTCTGCGCGAAATATGCTGTTTGCT
AATCCAGTTTGAACCAGGCGCTCTGTCCAAGGCGGTCGGTGATCATCTCGTCGCGAAGGGGATTACCATCTCCAACATAA
TCTCCAGCACAGAGTACGTCGGTCCTTTCTCGTTGCCAGATCGCACATTGACACGCTCCTTATAGGGCTCTGCCGTACGC
GCTCCAGTTCCAGGACAACATGTCCGAGTGGGAGTATTTCATTATGCGCGACGAGATTATGGGAAGCGACTGGAGGCCTA
TTGCCGGTAGCGACAATATCTATGAGCTCGTCCTGGTGCGCCAGACGCCGCGCCAGAAGACTCCCGGCATGCATGTGGCC
TTTTGGACCTTCCCGGAGCTCGACGAGTGGTCTACGCGCGATCTGTACCAGCGCCACCCGACAAAGCCCGACCACTGGAA
ATACCACGGCCGTATCGACAGTATCATTGTCTTCTCCAACGGCGAGAAGCTCAACCCCGAGGACATTGAGAAAACGGTGC
TTGGCCACCCGTCTGTGCATGGTGCTGTCGTTGTGGGCGCTGGGCGCTTCCAGGCCGCTCTGTTGATCGAGCCGAAGGCT
GCGGCACTTGCCGGTCAGACTGGCCCAGACGCAGCCGAAAGGCTGATCGAGGACGTGTGGCCGTACGTGGAAGCGGCCAA
CAAGCTGACCGTTTCTCACGGGCGTATTGCACGACCGTTCATCATCCTGGCCGATCCGGCCAAGCCGTTTCCCCGAGCAG
GCAAGGGTACGATACAGCGGCAGAAGGCCGTCAAGCTGTACGAGCACGAGATTGACGAGCTCTACCGACGGGTTGGTTCC
AATAGCAATGCTACAGAGAATCACGCCGGCCCTGCTCCCGTGGTCCTGGACACCAGCAGCAAGGCGGCCCTGGCCAAGTC
CATCCGCACCGTGTTTATCGATCGCCTTGGGGCTTCGCCACATCTGGAGGTGGACACGGACTTTTTTACTGTCGGTGCCA
TTGACTCCCTGCAGGTGATGAGCGCGATCCGTCTGCTCAAGGATGGCCTCGCGGCTCAGAGCAGCACGGAAAACGCAAGC
GTGACGCAGCGCGCCATCTACGGCAACCCAACGCCGACCAAGCTGGCCGCATACATCCTATCGATGGTCTCGGGCGGCAA
AGAGAGCGCGACGGCAGACGACGACGACGAGATTGGTCGGATGGAGGTGCTGATCGACCGGTACACGGCGAACCTCAAGG
CACCGTCCGCAAGCAGACGACCGGCACCACGCACGACTGGCCAGACGATTCTCGTCACCGGCACGACAGGTTCCCTAGGC
TCGTACATGCTGGACTCGCTGCTCAACAAGAACGCGGCCGTCCAGAAGGTGATTGCACTGACACGCGATGCGGATGGTGG
CAAGGTGCGGCAAGAACGGGTCTTTCGCAGCAAAGGACTCGACACGGCCGGGCTTTCGGATCCCAGTCGGGTGCAGTTCC
TGCACGCGACCCTGTCAGAGCCACGGCTCGGTCTGAGCGACGCGGACTACGACGGGCTGCTGGCGGATGTGGACCGCATC
GTGCACTGTGCCTGGCCGGTCAACTTTAGCTACAATGTGGCGTCATTTGAGCCGAGCATCGCGGGGGTGCGGCACCTGGC
GGACCTTGCGGCCGCCGCGAAGCGACAGGCGCCGCTGCTGTTTGTGTCGAGCATCGGCATGGTGGACAGCTGGGGGAGGA
CGAGCAGCGGCGCGGTGCCGGAAGAGCGGCTGGAGGACCTGCGTCTGGCCGGCATGGGCTACGGCCGGTCGAAGCTGGTG
AGCTGCCTGATCCTGGATGCGGTGGCAGCAGCGACAGACGTGCCAGTGCTCCAGGTGCGTCTGGGCCAGGTTGGAGGTCC
ACGAGAGGCAGGCGACAGCGAGGCGGCGTGGAACCGACAGGAGCTCGTGCCCAGCGTCATTGCCAGCTCTGTTTTCCTGG
GGGTGCTCCCGGACAGCCTAGGCGTGCTCGCGGTCGACTGGGTGCCGTCAGAGGATGCGGCCGAGGTGATCATCGAGCTG
GTGGCCGGCGACAACTTGCAGGGCAGCCACTACTACAACCTGGTGAATCCGACAGTGCGGACTTGGGCGTCGATCGTGCC
GCACATCCAGCAGTTCTACGGCGACCGCATCAAGGAGGTCGTCAGCCTCAAGGACTGGGTGACACGGCTGGAGGAGAGCA
GCCGCAGGAACAACAGCAGCACACCCGAAGCGGTGGCGGCCAATCCGGCGGTCAAGCTGGTAGACCGGCTGCAGGCCATG
GTCACGGCAGCGGAAGCGGGCTGGAAGCAGGCAACATTTGCGCTGGAGCAGACTAGCGAGCGCAGCGCGACAATGCGCAA
CATGGAGCCGGTGACGGGCGAGCTGGTGGCAGAATGGTGTCGGCAGTGGAGGTATTGAGTTGGAGGTAGTATGTAGCTGG
ACGATTAGTCATGAACATGTTTTGCCGAGCAACCGTGCCGTGACCGTGATTCGTGGATGGGAAGGGCAGGCCGTCGTGCG
TCTGCAGAGAGGCATGCAGGCCAAGACGGGTGGCCGTTCTGCGGTTGGCTATCAGGACAAGCCTGGCAGCCGGCCGTCTG
GCCGAGCGACCGGTCAAGCACAGGACAGCTTTGGCAGGTCTGCGGAGAAAGGGTCCTGCATATGGCAGAGCGGCCCGACA
TTCTCCGGGTGATTGTATTGTGGTTTTTTCGTTTCTTTTTTTTTTCGTTTCGTTTTTCGTTTTCTTTTTTCTTTTTCCGC
CTACTTTTTTTTCTTCCTTTTTCCTCTTGTTCACTCCCCTGTCGGTCATGCCATCATGCCGTGATAGACGTCGTGTGTCG
GCAAGAGATGCCTTTTCTTTGCCTGTTTGGCCTAGAAGCTACAGGAAGAAACGGCCCGCAGCTGGGGCTCCACCCAGCCC
ACCTTGACGAGGGGAGCGAGCAGTGACGTCGGTGAGTATTGTGTCTGTTACGAGTGTGCCTTCCGTACAGTGATTCGTTA
GTGTATTTTACATAATACATGTACTCCGTCTGCGGTCTCTGTTAGTGTACTCCGTCCGCTATCGCTAGCTGTTAGTGTGC
TTCCATCTACTCGTACAGTGTAAGATACCTCCATCTACAGACCTCCGTCTGCTGATGCTACTTATGTAGTGTCAGGCCAC
CACGATGGCGTGCATATTCGCCGTTGGCCGCGAAAGCCGCCTTGCAGCCAGTCATGGGCCACGTAGACAGGAATACGAGC
TGGCGAGGTTCGCGCAGAAAGGCCGAGGGACAGGCCCAGAAACAAGGACGGGACGGGAAAAGGGTTTGGCAGCCGGCAAG
CGACCGCGTGCAGCGTGCATCTGGCATGCTCTCGTCCTTCTGTCCTCACCGTAGAGGCCTTGGCTCAAGAGACTGCTCCA
CTGGCGTGCAGCCAGAGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62