GenePrediction:GLEAN_7144 Details

Name: GLEAN_7144
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3971220..3968376 (- strand)
Length: 2845
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3971220..3971092 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_140:3971032..3969085 (- strand)
Length: 1948
Type: CDS
Source: GLEAN
Position: GCSC_140:3969028..3968376 (- strand)
Length: 653
>GLEAN_7144 class=GenePrediction position=GCSC_140:3971220..3968376 (- strand)
ATGAGCGCCCGGCGAGAATCCCTGTCGGACTTTCGGCAGGCAAACCCGGATCTGGCTCTCAGCGGGAACATTATTTCTGC
CACCTTTAACATCCCCCACCTGCTAAACTACCGCGCGGGTGGCAATTGGGTGAGTGGAACAGAAGACTGAGACAGACTGG
ACAGCTCGCTGACAGGTGCAATTGACAGGACCTCAAAGCCCGCCGCGGCCAATCGGCGCTCTTCGACTCGTTCTCCTACC
TCTCGTCGGAGAAGTCGCCCTGGAACCACACGGTCGTTGCGTGGACGGGCGAGATCCAGCACTCGGTCGAGACGCTCTCA
CCGCCCGACACACCGCCGACGACGGCCAATGTGGGCGCCATCAACCCGCTCTCGGCACCGATCTCGATCGATGGGTTCCG
GCCAATGATGCCGCAGCAGTCGGACAGCGACGGGCTGTTCATTCCGCGCGACGACATGGTGCGCCTGGAGCAGCAGCTCT
TTCACGACACGCGAATCAAGACGGTCCCGGTGTGGTTGGCCGACGACGCCAGCCCAGATGCGACGGAGGACGGGGTGCGG
CTGATCGATCAGGCGCGGTGGCGACGGTATGCCGAGCACGAGCTCTACGGGCTGTTCCACTACAAGCAGCACGCGCCAAC
GGACAGCCGCAAGGAGCGGGTGCACTGGGCAGACTTTTACCGCTTGAACCAGAAGTTTGCCAACCGGATCGCAGAGATCT
ACAAGCCAGGCGACATTGTGGTCGTGCACGACTACTACCTGATGCTGCTCCCGAGCATGTTGCGCCAGCGGCTGCACGGC
GTGTACGTGGCCTTCTTCCTGCACTCGCCCTTCCCCAGCAGCGAGTTCTTCCGCTGCCTGCCACGGCGCAAGGAGGTGCT
GGAGGGTGTGCTGGGCGCGAATCTGATCGGCTTCCAGAGCTACGGGTTTGCGCGGCACTTTTCCAGCTGCTGCACGCGGC
TGCTCGGGTTCGAGGCCACGGCCACGGGCGTCAGCGCATACGGATCACACGTGGCCTTTGACGTGTTCCCGATCGGCATT
GACGTGGCCAAGGTCGAGCGGCTGGCGTGGGGCGAGGCGGTAAACCGCAAATACCAGGCGCTGCGCACGCTGTACGCAGG
CAAGAAGATCATCGTGGGGCGCGACCGGTTGGATAGCATCCGCGGCGTGGACAAGAAGCTGCTGGCGTTTGAGTGCTTTT
TGGGCAAGTACCCAGAGTGGCGCGACCGGGTGGTGCTGATCCAGGTGACGAGCCCGACGTCGATTGTGGAAGAGGAGCGC
GACAGCGAGGAGGCCAAGATTGCGAGCCGGGTGAACGAGCTGGTCATGTCGATCAACGGGACGTACGGCTCGCTGGGCTT
CTCGCCCGTGCAACACTACCCGCAGTACCTCAGCCAGGACGAGTACTTTGCGCTGCTGCGAGCCGGCGACATTGGTCTGA
TCACGTCGGTACGCGACGGTATGAACACGACGAGCCTGGAGTACGTCATCTGCCAGCGCGACAACCACGGGCCGCTGATC
ATCTCCGAGTTCAGCGGCACAGCCGGCAGTCTGCGTGAAGCCATCCACATCAACCCATGGGATTACACCGTCGTGGCGGA
CGCGATTCACCGCGGCCTGACGCTGCCGCAGCAGGATCTGGACCGGATGCACGACAGCCTGTATGAGCATGTGACGACGA
ACAACGTGCAAAGCTGGGTGACGGGGCTGGTCGACCGCCTGGTGCACGTGTTGAGCGCGCGCAAGAATGTGGAGGCGACT
CCGCCGCTGGATCGGGCGACGCTGCTGACGCGATACCGCAGTGCACGGCGGCGACTGTTTATGTTCGACTACGACGGCAC
GCTGACGCCGATTGTGCGCGAGCCGAGTGCAGCGGTGCCGTCGGGGGCGATTATCACGGCACTGAAGGCACTGGCGGCCG
ATCATCGAAATGCGGTCTGGATCATCAGCGGGCGCGACCAGGAGTTTCTGAGCAAACACCTGGGACATATTCCCGAGCTG
GGCTTCAGCGCAGAACACGGCAGCTTCATGCGGCATCCAGGGCAGATGGAGTGGGAGAATCTGGCCGAGACGCTGGACAT
GGGCTGGCAGAAGGACGTCGTTGCGACGTTTCAAAAGTACACGGACCGAGTTCCAGGTGGGTTTTTCCTTTTTGTGTTGT
TCTTCTCCATTTCTCTTCCCGCTGACAAACAGGCTCCTTCATCGAACGGAAACGATGTGCCCTCACGTGGCATTACCGAC
TGGCCGATCCGGAACAGGGCGCACACATGGCGCGCGAGTGCCAGAAGGAGCTGGATGCGACGGTGGTTCGATCATGGAAT
GTGGACGTGATGACGGGCAAGGCCAACCTGGAGGTGCGGCCGACGTTTATCAACAAGGGCGAGATTGTCAAGCGGCTGGT
GGCTTCGTATGGCGCCGACATTCAGAGCGTCTGTGGAGGCGACGTGGAGACGGCTGAGTCAGCAGTGACCCCTGTTCCGG
CAGCGACGCTGTCTCCGGCCATGCCACAGCACGTCGCGGCGGCCAACAGCGTTAGCGCCAGCGAGCTCGAGTTTGTCCTC
TGCATGGGAGATGACGCCACAGACGAGGACATGTTCCGGGCGCTTAACGGGCTCTCGTCGCCGCACGATGACGGCAGCCC
GGCCGACGTGCTGTCGGACCAGCTCTTCACCGTCACCGTCGGCCCCAGCACCAAAGTTACAGTAGCTCACTGGCATCTGC
TGGAGCCCGAGGATGTGATCGAGACGGTGTCTCTGCTGGCCGGTACGGGTGACAAGCAGCCCGAGTTCATGGACGAGGTG
AATTTGGCCGTGATCAGTGCCGTGGATGGTCACGTGCCAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62