GenePrediction:GLEAN_7145 Details

Name: GLEAN_7145
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3953741..3951438 (- strand)
Length: 2304
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3953741..3953706 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_140:3953630..3953601 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:3952901..3951438 (- strand)
Length: 1464
>GLEAN_7145 class=GenePrediction position=GCSC_140:3953741..3951438 (- strand)
ATGGCTCCCAGAACAAACGACTTCGAAGTGACCGAAGTAAGTGCTTCCAAATATCCAAGATCTGCTCTGTTTTCACGTCA
TCGAACATCAATGCTAACTATGATGTAACAGACGCCTTCAACTTACGATTTGATCATCACGGTATTGAAGAAGAAGTGCT
ATGCCTACAAGTCTATATCACGCCGAATTAATTGCCGTACTTTCGAAGCATGTAAGGATTCGGCACTAAAAGCATCAGCA
CTAAGCAGAGTCATGGACGGCTATGGCTTTCATATCGATGATGACGAAATCAGAAGGGGCGACTATTTCCATCATAGCTA
CGCAGAGAAATCACACCCTGGAATTCAGATGGTGCCAGACAACGAGCTTGCTTTACACATCAAGTTCGAAGCAGTCTTTA
GAACAATGATCCTTTGTCTTGATCCGGCAGAAGTTGAGTACTATAGGTGGAATCTTCCCGCGGAAAGGGTCGGGCAGGAG
ATGTTCAGTCTTTCAGAGGAAGAATATGAGTTCCAGAAAGCCAGACTGCGGTCTCAAGTCAATTTGAAGAGGCAACCAAG
ACTGGCACGGTTTGCAAAGAAATTTGTATGGGCGATCCCGCCTACAGTAGCTCCCCAGGTCCAGATGCCACTGCCACCTG
CCGTTCCTGAGCAGGTTCCTCAGCCGCAACTTCCCCAGCCGCAGCTTCCACAGCAGCAGCTTCCCCAGCAGCAACTTCCC
CAGCAGCAGCTTCCCCAGCAGCAACTTCCCCAGCAGCAACTTCCCCAGCAGCAACTTCCCCAGCAGCAGCAGTACGATAA
TCTACAGGCAAGTGCACTGACTCACATACCCATAAGCCAGTCAGGCACGCAGCTTCCCGACCAGGAAGAAAACCAGCTTA
TGGCCCAAGTTGCTGGCCAGGAGGAGCTGGACTTGCAATATTCCGATCAGGATATTGAGGAGCTCATGGATTTTGGACAG
ACGAATTTTTCTCTTCCTGGCCAGCAGTCTGATCAGCCGCTGGGAACGTTCAGCCAGGAGGAACCTCTTGCCTCTGAGCT
GAATGGACAACAATTTAGTCAGCCAATCGATAACACATTCGAGGGAGCTCTTTCCTTTCAGCTTCCTGACCAACAATACG
GTCAGCCAATTGATAACACAGTCAGCCAAGGGGGAGCTCTTTCCTTCCAGCTTTCTGGTCAGCCATTCAATCAGCCAATT
GATGTGCTTTCCTCTCAGCTTCCTAGCCAGCAATTTAGTCAGCCAATGGATAGCACGGTCAGCCAGGAGGTTCCTCTTTC
CTTCCGGCTCACTGGTCAGCAATTTAGTCAGCCAATGGAGAACACAGACAGCCAGAAGAGACCTCTTTCCCTGCAGTTTC
CTGGACAGAATTTTGTCCAGTCACCGGATCAAATTTCTGTCCAAGAAACTCCAGTTTTCCAGCTTCCAGACCAGAGAACC
TTCCAGCGTCGCCATTACCCCTACAGACAGCCACAGACTAATGTCCCTAGCCAGGGAATCCCCAAGTGTCTCCATCGGTC
CTCTTATAGGCCACTGGCTAATCTTCCTGACCAGGGAGCTTTACAGCTTCCCCTTCAGAACTATTTCCAACCAGTGGCTC
AAGTCTTTAGCCAGGAAGCTCCAGCCTCACAAATTTCTGACCAGCAGCTGGCTGAGCTATCACTTCCGGGGTTTCATCAA
GCACGGCTAGATCTCCAGCAGCCTAGCCAGTCGCATCCACCACTGTTGTCTCTGCCACAAATCACACCGCAGCAGCAGGA
GACACAGGAAAATGCCAGTGCTCAACTCGAGCTAGATCAAGCTACAATTCAGGTACTTGAGCTGCTCTTCCCACCACGAA
AGCCGACATCATCTCGTGGACGGCTGCAACTGCCCGTACAGCCACAAAATGTACAGCAGGATGGTTCCAAGATGGGAAGG
GCCTTGATGAACATTGGGCAGCCAGCAGCACAGGAGCAGAATATCCTTCCTGAACAACCCCAACAGCCTCAGCATGAGGG
ACAAGATACCCTCGGGATGGATTTGGCACTGGCTAATTATGAGCAGACAGAACCACAGGGACTGGAGATTTTTTTTGATG
AGCCGAAACAGTCCAGTCAAGGTATCATGTTGTCAAGACAAGAACAGGACAAGGAGAAGCTTCGGTTGCTACGTCTGCGT
GTAGCCTTTCTACAAAACCCAGAGGCAAATCCCCTACCGCCTTCGGTAGCCCCCGAACTCGGTCACCAGAAGAGCGCCCG
GCCAAGAATTGGCACGCAGTGGCAGCACAATACCTTTGGCGAGTTTCTGAACTTGGAAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62