GenePrediction:GLEAN_7168 Details

Name: GLEAN_7168
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3704424..3699293 (- strand)
Length: 5132
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3704424..3703019 (- strand)
Length: 1406
Type: CDS
Source: GLEAN
Position: GCSC_140:3702715..3702462 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_140:3702281..3702148 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_140:3702091..3699293 (- strand)
Length: 2799
>GLEAN_7168 class=GenePrediction position=GCSC_140:3704424..3699293 (- strand)
ATGGCTCAACAGGGCGCCGGGACTCCTGGCTGGCCCATCAATTACGAAGATGGCCACGCCTTTTCTCTCTCACACTCGGT
CGATAATGTTGACGACCTCCTGTCTCTGAACACACTGCCCCAGCACCAGCTGAATGCTTGGCAACATGCAGACGTGCCAA
CCACCCAGGCCTATAGCCACGGTCAAACCGCCCAGTTTTCCATGAGCGGCCACCCAAGCCAACCTGAGTACTCTGACATT
GTTGGGGCAGGCCATCTGCATGGAAATGCAGCGCAGGCACAACAAAGCTGGCAAGCATACCAGCTTCCTCCGCAGGCCAG
CCATTCGCCGCCACCAAATTTTGCAAATTCTCATGGTTCTCATGGCTTCGATCCAGCACAGAACTTCGGGGGTTCCATCA
CTGGTCCGGCCAGTGGCATGGCCTTTGGCAGCCAGGGGTTTCCGACAGCTGACGAAACGATGGGCGGCATGTCATTCCTT
CCAGAGCAAATTGGGGATAGTCAGCAGTGGCATCAGCAGCAGCAACAACAACAGCAGCAGCAGCAGCAGCAGCAACAACA
GCAGCAACGGCATCAACAGCAGCAACAGCAACAACAACAACAGCAACAACAACAACAGCAACAACAACAACAGCAACAAC
AACAACAGCAACAACAGCAACAACAGCCGCATATCCTTATGCAAAACCGTGGAGAGATGTCGGGCTTTGCTTTCTCTGGG
CCTGGCGATGCAAGCTCTATTTCTACGGCCTCGCCTGCCGCCCAGACTACTGCAGCCGCATCGAACATCGGCAGCCGGAT
GGAAACGCGGCAGGCTTCATACCAGAATGCAGCACAAGCATGGCAACAACATCACGATGGCCAGCAACCAAGGCAGCCCA
TGTTGCCAGTCCAGCACACAAATGTTGTCTCGCAGCAGCAGCAACCTCTACAGCAGTCTATGCCATCGGTATCGCAGCCG
TTGCAGCTATCGACAGCGCCCCAGATGGCACAGGTTTCACAGGTGTCGCCTCCGACTCCCGCAGTTGCCGTTCAGGCAGC
AAAGCCGGCTGCAAAGCCCAAGACTACCAGAGCTTTAAAAGCCAAGCAACCAGCTCAGACGGTGCAAGATGCCCAACAGA
TGCAGTCCCTCGATGCGATGCAGCCAATGCAATTCTCTCAGGCACCGCCGATCCAACAACAGATGTACCCGCTACAAGGC
AACGAGTCTCAATCCAATATTCAGCAACAACAATTGGCAGGCGGGTTTCGGCAGGCGCCGCCACAGCAATCACAGGCTCA
TCCAAGTAACTGGCAGCAGTCTAATTCTGGTCTAGCACACACGGAGGCCCGTTTTCAAGGCCATATCAACCCAGAAGCTT
ATAATCAGAGCCCGCCACCATCGTCGTCTGCGACTCCACAAGGATGGTCAGAGCAGCAGTTTCAGCAACATCAGCAGCAG
TATCAACAACAATTCCAGTCGCCTCCGCAACAGACACAGACACGGACCCAAATTCAGCAGCTGCAGGCACGGCAGATGGC
AATGCAACAGCAGTTATTGCAAAAGCAACAGCTCCAGCAGATGCGACAGCAGCAGCAGATGCAGCAACAACAGCAGCAGC
AACAGCCTGCATCTTTTGCCCAGCTACAAGCAGCTCAAGCACCCCCTGTGGGCCAAAACAGACCCGCGCTATACTCTGCT
TCTCCGGCAACTCTACCATCAATTTCTAGTTATTCGGCCCCGCCTCCGAAGCCCAAGCCGGCCAAGCCGACATTTAAGAA
AGCAAGCCTGGCAGACTCTCGTCCGAAGCTGATTCCCCACCTCGTTAGTGCTGCGGACACTTTGGAGAGAAACCAGTTCT
TTCCGGGCGTGCCATTTCTGGCGCTTGGTAACATGGTGGACATCGAGCCTCCTACGACCACGATCGAGCCGGCCGTCCAG
CCGGACCCGACCAAGGAGCTAGGAAGGAAACATTTCCCTGGGCGTAAGGGAAATCTTCCCTGCGAAATTATTGCGTATTA
CGATCGACTTGTCAGCACTCAGCCCTCGGAGAAGAAAGATGGATTGATCGCCGAACTCCGTAGCAAGCTTAAGAGCCAAG
GAAAAAGTAAGCTGTCTGCTTCCATCTGGCTATTCGTTATTCGCTAATCGGTTTGTTCTACAGTGCTACTTCCCAAGGTA
TACAAATTTGCCTCTCTGGGCGATCAGCCCAAACGGTCGACACATGGCGCAACGATACAAGGACGGAGCCCTGCGGAAAT
GGACTCTCCCGATAGCGACGAGGAAGAGGAAGAAGAAGTGAGTTAATTAGCACTTTGGCCCGGAAGACTGCTTAAGTTGC
TGACAAAAACAAGGTACGCAGTGCTACGCGTCCAGATGATCCTGCCGATGCAGCAGCTTGGGATGCCATCGGCTTCGTCC
ATGTGGAAAACAACAGTCCGCCAACGATCAAGCGGGCTGTGAAGAACTTTGGCGACTTCATCAAAGGCATCTACGATGGC
ATCAAAGAGACGAAGGAGAAGCTCAAGAAGGCCGAAGAGGGCAGTTCCAAGGAAGCTGCCGATACGTTCAAGAAGACGCT
CGCTTCCAAACAAGAGCTGCTACTCCGTGCGGTGGATGCTGCCGACGAAAAGGGACACGAACAGGTGTTGGAAAATCTAG
GCGGCAACGGCCCTTTGGTGGCCAACCTCGTGTCCGCCCTCAGAGATTGCGTCAATGCGTCTGATTTCGTCGGCAAGCTT
CCCAAGACGTTGCTTCGTTTCATGTCGCAATTCACCACAGTGACAGACGAAATGCTCAACCAAAAGCTCAAGTTCGACAA
GATCCAGAAGCGGTTCATGACCAAGGGCGACGATGAAGTCAAGGAACTGGTGGGGGAGATTATCTCGAAAACCGTGCATC
GCAAATCAGAGCGACCTTCGGGGCCGGTGGTAGCCTCCGCATCGGCTTCTACCCTGGGCTCGCGGCCGGCCAGCCGAGTC
CCGTCAGATCCCCTGTCGGCTAAGAGACCTCGGGAAGAGGACAGCGACTCTCGCTCGACGAAAAAGGTGGCCACCAGCTC
AGGAACCCCACAACTTGTCGGCAGACCTGCACTGGCAAAAACAACAACTCCCGCCTCTGGTGCTTTTCCGACAGCGCTGT
CAGTATCGAAACCATGGGCTGGCACTGCTCTGCTGCCGGGGAAGTCGAGGCCTAACCTCAAGCCTTCAGTCCCCAAGGCC
GATTCTAAGGGGGACCCTTCGCATCTGGCATCGTCGGTCAAGACAGAAACGAGCAAGGAGTCAGGCAGAGTAGTTGGCAC
AAGCGGGTCCGGCTTGGGATCTGTCAGGCGTGACCCCCCGGAAGCAGCGAAGCCGAGCGACCAGTACAAGATCAAGAAGC
TGTCCGCACCCAAAGCAGAATCGTCGTCTTCGGCCGCTAGCCAGTCGAAGTTGGGCGCATTGCTGGACGAAATTTCCATG
GCGAAGAGCGCGGCACCGACAGCACCGACATCCGAATCGTCGGGCGAGAGCTCGGCACCGACAGAGTCGGCCGAGGAGAA
GGCCAAGCGTCTCCGCAAGGGGAGCAGGAGGAAGCTGCGGGTTACGTGGAAGACTGGCGACGAGCTGACTGAAGTGCGCG
TCTTCACCAAAGACAAGGACGAGGACGAGGGCAGAGCTAACTACCTGCTCCGTGACGCGGGTGACGACCGGTCGGAAGGT
CTGGCGCTCAAGCGCAGCCTCAAGAAGGGCGTCAAGTTTGACGAGGAAGAGGAAGAGGACGGCAGCAGCAGCGCAAACGG
CAACAACAGCAGCAGTGGTGACGATGACGATGAGCTGCCGTATCGGCCGTGGTTTGAGCCCTCGACCGTCTCCTTTTCGG
CGATCCCGGCGGAGAAGAGGGAGAAGACGTTTAGCACGCGTGGAGGCAGCATCCCGGTGCAGACGGACGAGCAGAAGATC
ATGGCCGAGCGGGAGAACACGGTTCTCATGGCCGTGTATACCGATCCTGCCGACATCCCACCGACGCCGAAATCGCCAGG
ACCAGCGGGCGAGACAGCTACTGGAGGCCCAACAGGACTAACGCTTCCGACGAACGACGCCAAGATCCAGGAGCTGCAGG
TGCGCTGGAACGAGGAACGGACGATCGGCTCGGATTGGGCGGCCTGGAATGCAATCAGCCGAATGGACAGCCGGCGGAAG
CAACAGCCCGGAGCCAAGACAGCACGGACAGGACGGAGCATTTCTGCATTCAATGGACCCAGAGCGGAAGAAACCGTGCG
GCTGCTGGGCTCGAGCACGATCAAAGGATGGACAGGCTTTCCGGACCTCTCAAGAGTGTCGTCGCGTCGTCCCTGGCACG
AGTACACGGATGCAGCGATGCAGAAGGCAGTGCGCGAAGTGGAGGAGGTGGTGCAGCAGCTCAAGTCGAAGCCGTTTCCG
GCGATCGAACCGCCCGAGTACATTACCAATCCAGAGCGGCAAAAGGAATGGTGGACGGGATACAACCGGGATGCACAACG
CGAGAAGGCCCGTGTGGCAGCAGCAACGGCAGCAGTGTCTCAACAAGTCCCAGCAGCACAAAACGGACAGCAACAGGATG
CAGCAGCTGCTTGGGCAGCAGTCTATGCTCAGTTTGGCCAGCAGCAACAGCCACAGCAAGGCAGCGACCAGCATAATGCC
TATGCTCAATACTGGAACACCATGGTTCAACAGCAGCAGCAGCAGCAGCAATCTCAGGCAGCCGTGCAGACGACAGCAAC
AGGCGACTCCAACGCCCAGCTCCAGGCGCTATTGGCAACGCTTGGAGGAGCACCACAGGCGACCCCAGCCATGGCGCAGA
TGCTGCAGCCAGGCACAGTCGCAGGAACTGGAGATGCCAATCAGGCCTACATGCTCTCACTGGCACAATGGGCCGCGGCA
CAGCAGCAGCAGCAGGCCGAGCAGGCAGGGGGGTTCGGCGGTGCAACCGACAGTAATGGGGCCGGCAAGCTTGCGATCGG
GGCTCACGGCCGCAAGCGGGAGCGCGAACGGGACTGGGATAAGGACGAGGATCCGTCGACTCCAAGCCATCTGCGCGGTA
TCAACAGGGCCCTCATCGGCACCAAGGCATGTGTTTTCTGGGCCAGCGGCAAGTGTGCTAAAGGCGACAAGTGCACGTTC
CGGCATGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62