GenePrediction:GLEAN_7169 Details

Name: GLEAN_7169
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3694372..3693587 (- strand)
Length: 786
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3694372..3693587 (- strand)
Length: 786
>GLEAN_7169 class=GenePrediction position=GCSC_140:3694372..3693587 (- strand)
ATGGTGCTCACACATACGACTAACGACGTCTACTCACACCCGTTCCCGACTGTCACATTGGCTTACTTCCTCCGGTACTG
CTCGCCACAGCTCAACCCGTTTGCCCGCCATGTGCTTAGCACCGACACGATCTCAAGCCGGGTTGACGCGGAGACCGGAC
GCCTGCACACGACCCGCATCCACCTGAAGAAGTCTCGGCTGCCCAAGGCTGTGCTGAAGCTGCTGCCCACGAGCGTGACC
GGCGGCATGACGGACAAGGCGTCGTACATCCTCGAGACGAGCGTGATCGACATGCGCGAAGGCTGGATGCGCTCCGAGAG
CCGCAACCTCAACTACACCGGCATCCTCTCTGTCGTCGAGCAGCAGCTGTACACGACGTCTCCGCCCGAGTCGCAGGGGC
AGGCGGCTGCGACCAGCTCGACTGGGGTCGAGACCAACGTCATCTTCCGCTCACGGCTAGGCGAGCGCATCCGGGAGCGG
TTCGAAAAGGGCCAGCACCGGTACCAGCAGTTCAAGCAGCAGGCACAGCAGCATGTGCAGCAGTCCGCCGTCGACGACGC
CCACTCGGGCTGGTTCAGCACCGGGTGGGTAAGCGATCTGGGCGCCAAGGGCGTCCAGCGCAGCATCGAAATGATGGCGT
CTACGAAGACACAAGACCAATTGGGCAAAAGCCGCGAAGGCATGCGCATGATCCTCGAGCGGCTGCGCCAGACAGGCATC
ATGGGCGTGCTGGAGCTGCGGCGGCGGGCTATGGAGGGCAACCTCGAGGCATACGAAATCCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62