GenePrediction:GLEAN_7170 Details

Name: GLEAN_7170
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3687384..3685468 (- strand)
Length: 1917
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3687384..3687220 (- strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_140:3687158..3686787 (- strand)
Length: 372
Type: CDS
Source: GLEAN
Position: GCSC_140:3686739..3685468 (- strand)
Length: 1272
>GLEAN_7170 class=GenePrediction position=GCSC_140:3687384..3685468 (- strand)
ATGCCGCTCCCTACTTCTTCTGTGTTCCCGCCCTCGTCGGATGTCTTCCAGAAGTTCTCTAGCCGGCGCAGCGTGGTGCA
CAGCACCAAAGGCATCGTATCCTGCTCGCAACCGCTGGCAGCAAAGTGTGGCATCGACATTCTCCAGGCAGGAGGAAATG
CAGCCGTACGTTTCTGAACTCATGATTTAACTGAGTTTGGACGACAAACTAATAGCCCTCTTCCAGGATGCCGCCGTGGC
CGTGGCCGCTGGCCTGAACATGACAGAGCCGTGTTCAACCGGCATCGGTGGTGACATGTTTTGCCTCTTCTACGACGCTA
AGAAGGGCACCGTTTCGGCTCTCAATGGATCTGGCCGGTCTGGCCACCAGTACACTCTGGAACGCATGCGCACCAGCTTG
GGCCTGCCCGCTGGCGAGTCTAGCGGCCATATCCCCCTTACCAGTGTGCACGCTGTCACTGTTCCTGGTGCCCCAGCTGG
TTGGGATGACACCATTGGCCGATTCGGCAGCGGCAAACTCACACTGGCACAAATCCTGGCCCCGGCCATTGCCCTGGGCG
AGAACGGCTACCCAGTCTCGGAGCTGACTTCGTCATCTGTACGTCCTAAGTGTCACTGTCGACCTTGCCCTGACTAACAG
AGCAGTGGCAAAAAGGAGAGAAACAGTTGCGCCAGGCGTCGCCCAACTTTGCCGAGTGGCTGAAGAAGGACCCCAGTGCG
CCCGACGGCTTCCGTGCCCCTCGGCCTGGCGAGATCATGCGCAACGTGACCCTGGCACGGACTTTCCGGGTGTTGGGCGA
GGAAGGAAAGAAGGGCTTCTACACGGGTCGCGTTGCCGAAGCTATCGTTCAGGTGGTACAGGATCTTGGCGGCCATCTGG
ACCTCTCGGACTTGGCGTATCACATGGAGAAAGGCTCTGAGCCGGTGAACCCCATCTCGATCAAATATGGCGATGCGAAG
GACGGCGTCGAGGTCTGGGAGCACCCGCCCAACGGCCAGGGTATTGTGGCCCTAATGGCCCTAGGAATCATACAGACGCT
GCAGAAGCAGGGCACCGTGCCGCAGTTTGGCCCTGCCGACTTCAACAGCACGGCGTACCTACACGTGATCATCGAAGCCC
TGCGCATAGCCTTTGCTGACGCAAATTGGTTCATCACCGACCCCAACGAGGTGGCCGTACCCGTGTCCGGCCTTCTTTCG
CCCGAGTACCTGGCTGAGCGGGCCAAGCTGTTCAACCCGACCGGCGTCGTGCGACACGTCGACCACGGTACGCCTGGCGG
ACCAGCCTTCAAGTCACCGGCCCTGCAGAGCAGTGACACGGTGTACTTTGCGGTATCGGATGCAGAGGGCAATGCCATCT
CGTTTATCAATTCCAACTACGGCGGCTTCGGCACGGCCATCGTGCCCAAGGGATGTGGCTTCACGCTGCAGAACCGTGGC
GGCAACTTCAGTCTTGATCCACGACACCCCAACGTAATTGCACCACGCAAACGGCCCTACCACACCATCATCCCCGGCCT
GGTCACAAACCAGTCAGATCGGTCGCTCTACTCCGTGTTTGGCGTCATGGGCGGCTTCATGCAGCCACAGGGCCATGTGC
AAACGCTGCTGGGCCAGCTGGTTGGCGGCCTGAACCCACAACAAGCGCTGGATGCGCCGCGCATCTGCATCGGCGCCGGT
ATGCCGGACGAGGGTGACGTGTTTGGCAGCGCCGTGTCCGTCGAGGACGGGTTGCCAGAGGAGACGTTGAAGGGCCTGCG
CAAGCTGGGTCACCGGCTGACCGTAGTGACGGACAAGGCGCGTGCACTATTTGGCCGCGGCCAGATCATCCGTTACACGT
TGGACCCAGTCGAGAAGATTGCAGTGTGGTCAGCCGGCAGCGACCAGCGCGGAGATGGTGCAGCCTATCCGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62