GenePrediction:GLEAN_7173 Details

Name: GLEAN_7173
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3671628..3670795 (- strand)
Length: 834
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3671628..3671428 (- strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_140:3671296..3671176 (- strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_140:3671117..3670795 (- strand)
Length: 323
>GLEAN_7173 class=GenePrediction position=GCSC_140:3671628..3670795 (- strand)
ATGATGATGCCACAACTGCTGCGACAGGGCCTTGCAGGGCTTGTGCTGTTCGCAGCCGCCAGCGAGGCGCTCAAGCTGGA
CCTGCACCCGACCAACGGCCATGCGCGATGTATCCGCAACTTTGTGGCCAAGGACACGCTGGTGGTGGTGACGGCGACGC
TGGACGGCCACCGGGGCGACGGCATGGTGGTGAACATGCATGTACGTGTGGCGAGCTCTCTGTTTGGTTTTGCTTTCTGT
GTTCCGTGATCTGTGTTCCGTGTTCTGTTCTCCTTTAGTCCTTCCCTTTCCTCTCTCCTTTTCCTTCTCTTCCAGTGTCC
TAACAGCTGCAGATCAAAGACGCCGTAGGCAACGAGTACGGCCGAGCCAAGGACATTGCCGGCGAGCAGCGCACCGTCTT
CACGTCGCACGCGGACGCAGCCTTTGACGTCTGTTTTGAGAACATTCTGAACCGTGAGTGGAGGGGTCCTCTGGGTCAAG
ACCGGGCAAACACAGAGACTGACGGCGACAGACCGGAGCAACAACGACGGGTACCGCCGGGTGGAGCTCGACGTGGACAT
TGGCGCCGACGCCAAGGACTGGGCGGCCATCCAGGCGACGGAGAAGCTCAAGCCGGTCGAGACGGAGCTGCGGCGCATCG
AGGAGATGCTCAGCGAGATCGTCGACGAGATGGACTACCTGCGCGTGCGCGAGCAGCGGCTGCGCGACACCAACGAGAGC
ACCAACACGCGCGTCAAGTACTTTGGCTTCGGCACCACCTTTCTGCTGATCGGCCTCTGGGGCTGGCAGATCATGTACCT
GCGCGCCTACTTCCGCTCCAAGCATCTGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62