GenePrediction:GLEAN_7175 Details

Name: GLEAN_7175
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3650161..3648290 (- strand)
Length: 1872
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3650161..3649952 (- strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_140:3649884..3649624 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_140:3649565..3649317 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_140:3649240..3648934 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_140:3648870..3648290 (- strand)
Length: 581
>GLEAN_7175 class=GenePrediction position=GCSC_140:3650161..3648290 (- strand)
ATGAGCGATTCAAAATCGGCCACAGGCGTCACCGACGTGCACCATGAGGGCGATATACCCGATGAGAAGGACCCCAAGGT
CCTGGCCAATGCGGATCTCATGAATGATGCCTTTGACGGCGAGAACCGCGAACATGAGATGGGTGCTTGGGAGGCGTTTA
AGAGCCATCCATGGGCCTGCTTGTGGGCTTTCATCATGTGCTTCACTATTGTCAGTCAAATCCGTCATTGCTTGGTTGAA
GTGCATGAGTATCCAGCTTACTAACGCTCAAATCTAGGTCATGGAATCATTCGACATGTTCCTCAACACCAACTTTGTCG
CTCTTACCGCTTTTCAAAAAAACTTTGGCGTCCCCGTCAAAGGAACTTCCGATTATTCTATCCCGACACGGTGGCAGAGC
GCTCTCTTCCAGTCTGGTCAGTGTGGTGCCTTTGTTGGTGTCTTCATGGCCGGTCCCATCACCAATCGGCTGGGCTACCG
CTGGACAACCATCTTGGCTCTCGTGCTGATGAACGCCACTATCTTCATCTCCTTCTTTGTGAGGCTCCCTGAAATCATTG
AGGTGGTGACATAATCTAACGGCCGTGTCTCGCCAGGCGGACTCTCTTACCGTCCTCGTCATCGGCCAAGCTTTTGAGGG
TGTACCCTGGGGTCTCTTCATCGCAAACTCCCCTGCCTATGCTAGCGAGATCGTTCCTCTCGTCCTCCGAGGCGCCTGCA
CAGCGACACTGCAAATGAGCTGGTCTATCGGGTCTATCATCGTCGCTGCAGTCACGTATGTCTACAACAGGAAGTCCGGC
CAGTGGGCTTACCGCCTGCCTCTGGCCTTGCAGTGGATGTTCCCGGTAAGCCTCTGTTCTTTACTACTACTCTACATCTT
CGCCTGCACGGGAAGCTTACGCTGACTGATCTCTCGTCTAGACCCCTCTCTTGGTTCTCGTCTTTCTGTCGCCCGAATCT
CCCTGGTGGCTCATTCGCCGTGGCCGTAAGAAGGAGGCTCTCCGTTCGATTGAGCGCCTCGGCGACAGGGCCGGACAGAA
CGCTCAACAGACGCTGGCGATGATGGAGCGTACCGTCGAGATCGAAGCGCAGATAGGCGGATCCCCGACGCTGCTTGATC
TCTTTAAAGGCACCGATTTGCGGCGGACAATTATCACGTGCTTGATGTATGCATCGCAGAACTTTGCTGGTAACCTGATT
GCAAATCAGGCCACCTTCTTCTTTGAGCGTAAGTCAAAGCCCCGAGACAGACGTTGACAAAAGGGAACTAGAAAGCTGAC
TCCCCATGCAGAAGCCGGAATTTCGCCCGAGAAAGCCTTCCAGCTTAACCTGATCAATTCGTGCCTTCAGTTTGTCGCCA
ACGTCTGCTCCTGGTTCCTGGCTTCCTGGTTTGGCCGCAGGACCATCTATCTCTGGGGCACAGCCACCAACATCACGCTG
CTCTTTATCCTCGGAATTTGCGCATCGGTCGAGCAGAACCACAAGACCAATCTTGCCCAGGCCTGTTTGGGTGTGGTCAT
CTCGTTTGTCTTTGCCGGTTCGCTGGGACCGATCTCGTACACTATCATTTCCGAGACATCATCCGTCCGTCTTCGGGCCC
TGAGCACGGGCGTCGGTCGTGCTGCCTACTATGTTGCAGAGATCCCGATGATCTACCTGGCCTCGAAGCTGCTCAACACG
ACGGGCTGGAACCTTGCGGGCAAGTGCGGCTACGTCTGGGGAAGCACGGCTTGCGTCTGCTGGGTCATGGCCTACTTCTT
CCTTCCCGAGCTCAAGGGCCGCTCCTACCGCGAGATCGACATCCTGTTCAACCGCAGGCTCCCTGCCAGGAAGTTCAAGT
CTGTCGTCATCGACGTCCAGGACAACCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62