GenePrediction:GLEAN_7178 Details

Name: GLEAN_7178
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3641506..3639808 (- strand)
Length: 1699
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3641506..3641477 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:3641375..3640984 (- strand)
Length: 392
Type: CDS
Source: GLEAN
Position: GCSC_140:3640873..3639808 (- strand)
Length: 1066
>GLEAN_7178 class=GenePrediction position=GCSC_140:3641506..3639808 (- strand)
ATGGTAGCTTCAGTGAGGGTTGTGCCCAATGTAAGTGACTGTTAGGGCTATTTAGCTTAAGCCGAAGAACCGACAAGACT
GCCAGGCACGGAGAGGGGGAGTGTTGTGGGCTAACAGTCTCTTAACACTAGGCCTCTGTGCGAGCTGTGAGTTTGCTGCG
GAGCATCCAGTTCGGGCACCCGCCGTCCTGTCCCTGCCACTCAAACCCGGGCCACCATCACCATCAGCAGGGGTCTGCCG
TGACACCGTACGCTCGCCGGTCACGACGGGGCTATGCGACGCCGCAGCAGCCGCAGAAGGAATATGCGTTTGAGCTGGCG
GCGTCGTCGATCCGGTTTGGCAACGGAGTCACGGGCGAGATCGGCATGGACCTGCAGAACATGGGGGTCAAGAATGTGGC
CGTCGTGACGGACGGGACGGTAGACAAGCTGCGGGCGATGCAGCAGGTGCGCGAGGCCTTGGATTCAGAGGGCATCCGGT
TCAGCGTGTTCAACCGGACGAGAATTGAGCCAAAGGACGAATCGTGAGTGCATTCTGTCTGCCCGGTTTTGTCCTGTTTT
CTTTCCTTCTTTCTTTCTTCTTTTCTCTTGTTTGTCTTCTTTCTTCTCTCTACATTCTCCTCTGACTTTATAGAATCCTG
GAGGCCATTGCATGGGCTAAGCCACTGGCCCCCGATGCCTTTGTGGCCGTGGGTGGTGGCTCCGTCATGGACACAGCTAA
GCTGATGAACCTGTACACGTGCTACCCGGAGGCGGACTTTCTCGACTTTGTCAACGCGCCGCTAGGCCGCGGCCTGCCGG
TAGACCGCAAGCTGCGGCCTCTGATCGCGGTGCCGACGACGGCGGGAACGGGCAGCGAGACGACAGGCACGGCCATCTTC
GACCTGGTCTCGCGACGGGCTAAGACTGGCGTGGCGCACCGCAACTTGAAGCCGACACTGGGCATCTGCGATCCGCTCAA
CACGGCGACAATGCCGGCCGCAGTCAAGGCCAGCTCCGGCCTGGACGTGCTCTGCCACTCGCTCGAGTCCTGGACGGCTA
TCCCGTACACCGAGCGCGTGCCACGGCCGGCCAACCCGCTTCTCCGACCGGCTTACCAGGGCGCCAACCCGATCAGCGAC
ATCTTCTCGCTCAGTGCCCTCCGCAGCACCGTCCGCTACCTTCCCCGGACCGTTCACAACCCGGACGATGACGAGGCTCA
GTCGCAGATGCTGCTAGCCGCCACTCTCGCCGGCGTCGGCTTCGGTAATGCTGGCGTCCATCTCTGCCACGGCATGTCTT
ACCCGATTTCGGGCCAGAACCCCGGCTACAAACATGCCGGCTACGTCGTCGACACACCCATCATCCCCCACGGCGTCTCT
GTCGCCGTCTCTGCCCCCGCTGTCTTTCGTTTCACCGCCGCCTCCAACCCTGACCGCCATCTCCAGGCCGCTGAGGCCTT
TGGGGCTGACATTACCAATGCCAAGCGCGAGAGCGCCGGCGAGATCCTTGCCGATGCCATCACCAACTTTCTCGATCTCC
TCGGCGACCAACCCCGTGGCCTCAGGGACCTTGGCTTCGGCCACGAGCACATCGACGGCCTCGTCGAGGGCACCATCCCC
CAGGCTCGCGTTCTCATGCTGGCCCCTGGCCTCGCCAAGGAGCTACAGGAGGAAAAGGACCAGCTGCGCCAGCTGTTTGA
AGATGCCATGACTCGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62