GenePrediction:GLEAN_7179 Details

Name: GLEAN_7179
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3634922..3632053 (- strand)
Length: 2870
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3634922..3634799 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_140:3634734..3634652 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_140:3634587..3634424 (- strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_140:3634370..3634237 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_140:3634175..3634087 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_140:3634028..3633925 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_140:3633866..3633737 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_140:3633676..3633510 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_140:3633445..3632053 (- strand)
Length: 1393
>GLEAN_7179 class=GenePrediction position=GCSC_140:3634922..3632053 (- strand)
ATGCGGCCAGAGACACTTCACTTAGGCCTCGCCGTCCTCGCTGGCTTGGGCGCCAGCCAGGCCTCGACCTTGATCGAGGA
AGACTCGTACTTCTATGGTCTCTCACCGCCAGTTTACCCGACGCGTGAGTCAGGCTCCGTCAACCGCTGCTTCTGGATTT
TTCCACGATCCTGACACGGAATCCATAGCAAATACTTCTGGCACGGGCAGCTGGGCTTTGGCCTACTCAAAGGCCAAGGC
CTTTGTGGCGAAATTGACACTAGAGGAAAAGGTGGCCAGCATATGTTGCGGCTCTCTGGCCGCTCATCAGAAAACACACC
GACTGACATATGCAGGTTAACCTGACGGCCGGTATTACGCCCACAACGGGCTGCTCTGGATCTGTACCAGCCATCCCGAG
GCTCGACTTTCCCGGTCTCTGCCTGACTGATGCTGGCAACGGAGTGCGTGGCACCGATTTTGTCAGCGCCTGGCCGAGCG
GCCTGCATGTTGGTGCTTCGTATGTTCAATCATGATCCGAGGTCTGGTTGTGCCACTGCTGACGTTTTCCAGCTGGAACA
AAGCTCTGGCCCTGAAGAGAGGCAAGGCCATGGGAAAGGAGGCCCTGAAGAAGGGCGTCAACACGCTCCTGGGTCCTGTC
GTCGGACCCATGTTCAGACTTGCTGAAGGTGGCCGTAATTGGGAAGGTGAGAACGCTCATCGCTTTTTGGAGACACGAGA
AGAACAAACGTCAGCTAATCTGAACAGGATTCGCTGCCGACCCATATCTCAGCGGTTCTCTGGCTGCTGAATCTGTGTCG
GGCCTTCAAGGGTCGGGTGTTATGGCCTGTGTCAAGGTGAGTAGACTTTGCTTGGAATACGATCGCTGGGACAGATCGCT
AACAACATGCATAGCATTACATCGGGAACGAGCAAGAGACACAGCGGAATCCCAGTGGAAATGTGTCGGCTGTTTCGTCC
AACATTGACGATACTACTTTGCACGAGCAGTATCTCTGGTAAGAACACTTGCTGCCTTGAGCCGAGGAGTGCACAGAGTT
CTGACAATTGTGGCAGGCCGTTCCAGGAAGCTCTCCATGCGGGAGCTGCTTCCATTATGTGCTCGTACAATAGGATCAAC
AACTCGTACTCTTGCCAGAACAGCAAACTCCTGAACGGAGTGCTGAAGGAAGAGCTGGGCTTTCAGGTAGGATTGTCTGG
GGCTCTCCACTTTCTGTACTGAACGTACATCTAACGGAACGACCAGGGCTTCGTTGTTTCCGACTGGTATGCCCAACATG
CTGGCTACCCTGCAGCTGCTGCCGGACTGGACTTGGTGATGCCCTCTTCGCTGACGTATTGGGGTGACAACCTGACTTTG
TCGGTACTCAACGGGTCCTTGTCCGAATCCCGGGTGGACGATATGGCTACTCGGTAAGTATTGCTTGGTGATTAAAGCTT
GTCTTTGGTTTAGGCCTGTCCTTTCTAACCGTTTTAGAATCATCTCTTCGTGGTATTTCCTGGGACAAGACGACTCGATC
CCGAGTCCCGGTGTAGGCATGCCTCTGGATCTGCTGTCACCGCACACGATTGTGGACGCCGTGGACCCCACAGACAAGTC
AATACTGCTGCAGGGCGCTGTGGAGGGTCACGTGCTGGTTAAGAACGTCAACGGAGCGTTGCCGCTGAAGAAGCCGCACA
TGCTCTATCTGGCAGGATACTCGGCGCGGGAACCGGCTGCCAACTCACCGGAGGACGGATATGGCTGGTCCCTGAACTGC
GAGTCATCGATCGAGATGGCCGAGGTCTTTGCCTCCACGCTGATTGGCAACGACCCGGCCTCTCGATCGCCGGCGGCTGC
CACCAACGGCACCATCATCTCGGGTGGCGGATCGGGGGGTGTGACTATGTCGGTCTTTTCGACGCCCTTCAACGCGCTCG
TCAACCGGGCGATGGAGGACGGCACGCAGATGTTCTGGGACCTGCGATCGGCGGCGCCGACGGCCGACGCGGCAGCCGAT
GTGTGCATCGTCTTCGGCAATGCTTGGGCGTCCGAGTCGCTCGACCGAGTCGGGCTGCGCGACAACGCCACGGACACGCT
CGTGACCAGCGTGGCTGACAGCTGTGCCAACACGGTGGTAGTGCTGCACAACGCGGGCGCACGCATCGTCGACGCCTGGA
TCGACCACGCGAACGTGACGGCGGTGATCTTTGCCCACCTTCCGGGTCAATACAGCGGCCAGGCGCTGGTCTCGCTGCTC
TACGGCGACGACGACTTCTCCGGCCGGTTGCCGTACAGCCTGCCCCGGCATGAGGACGACTATGGCAGCGGTCTGCTGTC
GCCAACCGTCGGCGCTGGAGACTACGCTCTCTTCCCCCAGGCCGACTTTGACGAGGGCGTCTACGTCGACTACCGGCACT
TTGATCGCGCCGGCACAGAGCTGCAGTACCCCTTCGGCTTCGGCCTCAGCTACACCACGTTTGCCTACAGCGGCCTCGGC
ATCCGGCGCCTTTCCGCCAGCAGCAGCGGCAGCAACCTCACATGGGCCACGTATCCGAGCGGTCCTGTCCATCAGGGCGG
CCAGACCGATCTCTGGGATGTGGTGGCCCGCGTGTCCGCCGTCGTGGCCAACACCGGCTCCGTGGCCGGCCAGGAGGTCG
CCCAGCTGTACGTCGGCATCCCCGGCGCACCCGTGCGGCAGCTGCGCGGCTTCGACAAGGTGGCCATCGGCGCTGGTCGC
TCGGCTACCGTGATGTTTACACTGACCCGCAAGGACCTCAGCGTGTGGGACTCAGCAGCCCAGAAATGGAAGCTGCAGAA
GGGCAACTACACCGTCTCCGTCGGTTCCAGTAGCCAGACACTGCCGCTGAAGGGTTTCTTAGTTCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62