GenePrediction:GLEAN_7182 Details

Name: GLEAN_7182
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3620493..3618836 (- strand)
Length: 1658
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3620493..3620377 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_140:3620305..3620280 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_140:3620218..3620175 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_140:3620117..3619944 (- strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_140:3619861..3619832 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:3619763..3619653 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:3619605..3619227 (- strand)
Length: 379
Type: CDS
Source: GLEAN
Position: GCSC_140:3619171..3619090 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_140:3619039..3618836 (- strand)
Length: 204
>GLEAN_7182 class=GenePrediction position=GCSC_140:3620493..3618836 (- strand)
ATGGCAGCCTCGAAGATGAAAGCTGTCAACTATGTTGGCCCTAACGAAGTCCGCGTTGAGGATGTGGAATTGCCCAAAAT
TGAACACCCTGATGATGTTATTGTAAAGATCACGACGGTGAGTCTGCTGCTTCCCTCACCTGGAATGAGGATGTCAGAGG
GTTTGCTGACGTTACATCTACTAATTAGTCAGCCATCTGTGGCTCCGACCTTCAGTACGGACCAGAGCCACCTGTGCGAG
ATGATATGATAGTCTGCTAACATTTTTCTACTCAGTATGTATGAGGGGCGAACAGCTGCTAAGCCCGGAATCACTTTCGG
TAAGGCTGTCCTTGTTCTTCATATAATACAACAGATAACTGACCCGTGTGAAAAAGGGCATGAGAACATGGGCATTGTCC
AGGAAGTCGGAGATGGCGTCTCTCTGCTCAAGAAGGGTGACCGGATTGTGTTGCCTTTTAACGTTGCTGACGGACGATGC
CGAAACTGCGAAGAGGGAAAGACAGCGTTCTGTACAGGAGTGAATCCTGGGTTCGCTGGCGGTGCTTACGGTGAGTTGTT
CTAGCCTGTTTCAGCAGAGGCTGCTGTAAAAGAGAAAGAGAGAAATGACATGCTAATAAAGAACATTCACAGGCTATGTT
TCTATGGGACCATATCGCGGAGGTAAATCAGCAATGCACTATCACTCTGAGTACAATATCGCAACAGTAGCTGACGAAAC
AATTGTGAAGGCCAGGCGCAATATCTTCGGGTCCCCTACGCCGACTTCAATGCGTTGCAGCTTCCTGCTGGTAAAGAGTT
TGAGGCGGACTTTATCCTCCTAGCAGATATTTTCCCTACCGGTAGGCCATTCCATGCTATCGTTCAGCGATATATCTGAC
ATGTACAGGCTGGCACGGCGTCGAAATTTCCGGCTTCCGGTCTGGTGAGAGCATCGCTGTGTTCGGTGCTGGGCCGGTCG
GCCTCATGGCTGCATACTCGGCAGTCCTGCGTGGAGCAAGCCGCGTCTATGTTGTGGACCGCGTCCCGGAGCGCCTCCAG
GCTGCGACCAAGATCGGCTGCACCGCGATCGACTTCTCCAAGGGAGATCCTGTCGAGCAGATCACAAAAGCCAACGGCGG
GCTGGTGGACCGCTGTGTCGATGCTGTTGGCTATCAGGCCAGCAACAGATCGGGTTCTGGCGAACAGGCCAACATCGTTC
TCGAGAACATGATCAGCGTCACGCGTCCCTGTGGCGGCTTGGGCATTCCAGGACTCTATGTCCCGAGGTAAGCGTCGAAC
ACTCGGCAGCCGGTAACCGAATCATTGTTAACATTGTCACAGTGATCCTGGTGCTGCCGATGCTGCAACGCGCAACGGAA
TGCTTAGCATCAGCTTCGGCAAACTCTTTGAAAAGGCAAGTAAGGTGGCAGACATATTGATGGAGCTGCGGCTTGCTGAC
TACATCACCTACAGGGCCTCACTATTGGCACAGGACAGTGCAATGTCAAGTCTTACAACCGTTACCTCCGAGATCTGATC
ATTTCCGGCAAAGCAAAGCCTAGTTTTGTGGTTTCCCATGAGATTTCAATCAACGACGCCGCAGATGCGTATCACAAGTT
TGCGAAGCGCATCGATGGCTACACCAAAGTGCTCATTCACCCAAACGGGGACTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62