GenePrediction:GLEAN_7183 Details

Name: GLEAN_7183
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3613259..3611480 (- strand)
Length: 1780
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3613259..3613206 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_140:3613150..3612293 (- strand)
Length: 858
Type: CDS
Source: GLEAN
Position: GCSC_140:3612233..3611919 (- strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_140:3611865..3611699 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_140:3611642..3611480 (- strand)
Length: 163
>GLEAN_7183 class=GenePrediction position=GCSC_140:3613259..3611480 (- strand)
ATGAAGACTCTAGATTACAACGCTGTCACTGTGGCTTGTGCCACAATCGGAGTGGTAAAAAGAAACTCCAAGCTGCTAAT
GCTTCATTCTACTAAAATCTTTGACCCAGACTGTATTCCTTTTTGTCGGGAACGTTTTCTACAACCTCTTTCTTCATCCT
CTGCGCAAATACCCTGGTCCGTTGCTACACCGAGCCACTCGTTTGGGCTATGTTTACAACTTGATGGGTGGCTTTCTGCC
TCGACACGTACTTGCCTGGCACGAAAAATACGGCCCAGTGGTTCGCATTGCACCAGACCAGCTCGCCTTTATCGACCCCG
AGGCCTGGAAGGATATTTATGGCCACCGGACGGGCTCATACATTGGCACAGAGGAAATGGCCAAGTCTGAGACCTTTTAT
GTCACGCCTCGCATCCCGCTGTCTATCATTACGGAGAAGCGCGGGAATCACGCAATATTGCGCAAAAAGCTATCTCACGG
CTTCAGCGAGCGGGCTATGCGCGAACAAGAACCCATCATCAAGAGCTATGTCGATCTTCTTATCCAGCGGCTGTACGAGA
ACTGTCATCTGCCCGAGAGCAGTACCGAATACAGTGACGATGCTGCGGCTGCTAGCGAGAAGACCCCCAAGCTTCAGGCA
TTGGACATGACGGTCTGGTACAACTGGACGACGTTTGATATTATTGGCGATCTGGCCTTTGGCGAGTCCTTTCACTGCTT
GAAAGATGTCAAATACCACCCATGGGTGGATGCCATTAACAAGACGATTCTTAACAACAGTGTGCTTATTGCGACCAAGA
TGATGTACCTGACATTCCTGATAAAGGTTTTCTTCGGCTTCGCTGCAGAGGGCCGCAAGAAGTCGTTGGAAATGAGCATT
ATCAGAGTCCAAAAACGCAAGGCACTTGGAGTAGAGCGTCCAGACTTTCTTGACGGCCTGATCAAGCCTGGAAAGAACGA
GAAGCAGGTAAGATACGACCCGCAAGTTGGCACGTATCTGCGTCTTTGCACTAACTGGTGCTGCAGGTTCTTGATATCCC
GCACCTTGCAAGCAATGCCAGCACTTTAGTTCTGGCTGGTTCAGAGACCACAGCCACACTCCTTTCCGGCGTGACCTATC
TGCTGCTTAAGAACCCCAAAACCCTTGAAAGACTGACTGCGGAGGTGCGCTCGACCTTCTCGTCCGAGAGCGAGATCAAC
TTTGTATCTGCAAATGGCCTTAGCTACATGCTTGCGTGTCTCAATGAAGCACTTCGCTGCTATCCACCGGTTCCCTTCGG
TATGCCCCGTATCGTTCCAAAGGGCGGTGCCACAATTGCTGGAAACTTTGTTTCCGCAGGTGTACGTATATACGAATCTG
CTAGATGATAGGGTTTTCATGCTAACAACAACAGACTTCCGTGGCTTGTTGGCAATGGGCTATGAACTACTCTCCCGTTA
ACTGGGAGGACCCGAACTCCTTTAAGCCAGAGCGGTTCCTCGAAGGCAGCAGAAATGTAAACGACAATCTCGATGCAATG
CAACCATTTTCGATGGGTCCCCGTAACTGCATCGGGCGGAAGTATGTCCCCCGTTTCTTCCCTGGACCTTGATTTGAATA
ATACGCTGACATTGCAGTCTTGCCTATACTGAGATGCGCCTGATCTTGGCACGCATTCTTTACAATTTTGATATACAACT
GGCCGATCCCAATCTGGACTGGATGGAACACCAGGGTTCGTACATTCTCTGGAACAAACCACAGCTCAATGTATACTTAA
AGCCCGTTGTTCGGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62