GenePrediction:GLEAN_7187 Details

Name: GLEAN_7187
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3588910..3585542 (- strand)
Length: 3369
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3588910..3588783 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_140:3588723..3588627 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:3588563..3588521 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_140:3588466..3588047 (- strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_140:3587972..3587433 (- strand)
Length: 540
Type: CDS
Source: GLEAN
Position: GCSC_140:3587367..3586673 (- strand)
Length: 695
Type: CDS
Source: GLEAN
Position: GCSC_140:3586595..3585920 (- strand)
Length: 676
Type: CDS
Source: GLEAN
Position: GCSC_140:3585855..3585542 (- strand)
Length: 314
>GLEAN_7187 class=GenePrediction position=GCSC_140:3588910..3585542 (- strand)
ATGGCCAGCGTTCCCCAGAGTTGCACCGTGCTAGTGGTGGGTGGCGGGCCCGGTGGCTCGTACGCATCCGCAGCCCTAGC
CCTCGAGGGCATCGATGTGGTCCTCCTCGAGGCGGAAGTTTTCCCAAGGTTCATTCCCTTACGTGCTGTAATGATACTTC
GACGGCGGCAACTAACCAGATTGGCAGATACCATATCGGCGAAAGCATGCTCCCCTCTATGCGACACTTCCTCAAGTTTA
TCGGTGCCTACGAAAAGTGGGATGCACACGGTTTCAACATCAAGGTAGCGCATTTATTGTGTGGATTTATTATTAGGCGC
AAACGTATTGCTGACGCTACGTAACAGAAAGGGGGCGCTTTCCGTCTGAACTGGTCCCGGCCTGAGACTTGTATGTCATG
AAACCCCTTGGGATTTAGCAATGCAACTAACATTTCTTTCAAAGATACCGACTTCATTGCCGCTGGTGGACCTGGAGGAT
ATGCCTGGAATGTGATCCGTTCTGAAGCCGATGATCTGCTATTCAAGCACGCCGCAGACTGTGGCGCCAAGACGTTCGAT
GGGACGAAGGTGACATCGATCGAGTTTGCCCCCCAGGACCAAGTGGGCGAAGCGGGTGCCAACACGGTTGGCCGCCCCAT
GTCTGCTACTTGGAGTCGCAAAAATGGAAGCTCCGGTACCATCACGTTCGACTATCTCGTGGACGCGTCCGGTCGAGCCG
GTATGGTCAGCACAAAGTATCTCAAAAACAGATCCTTCAACCAAGGTCTGAAAAACATTGCCAGCTGGGGCTACTGGAAG
GGCGGTGGTGTACATGGTGTTGGAACACACAAAGAGGGAGCGCCCTACTTTGAAGCTCTGAAAGGTATGTCTAGGCTGGT
TCATTGATGCTCCTGTTCCAATACGCTTGGGTCATATGCTGAAAGAGTTCTCTGCCAGACGCAAGTGGTTGGGTCTGGTT
CATTCCCTTGCACAACGGCACGCACTCTGTCGGTATTGTGCAAAACCAGGAGATGGCAATCCAGAAGAAGAGGCAAATGG
CTGAGCCCTCTTCGCTGGGCTTTTACAAGGAGGTCCTGGAGCTCGTCCCTGGAATCAAGGAGCTCCTTGCCAATGCTGAG
CTTGTTTCGGAAATCAAGTCGGCCTCTGACTGGTCGTATAGCGCATCCAGCTACGCTCTTCCCGGCGTGCGAATTGTTGG
CGATGCTGGGGCTTTTATCGACCCTTTCTTTTCCTCGGGTGTGCACCTGGCCCTTTCTGGTGCGCTTTCGGCTGCAGCCA
CCATTGCTGCCGCTATCAGAGGCGATTGTGACGAGGAGACGGCATCGTCCTGGCATGACAAGAAGACTGCCGAGAGCTAT
ACTCGCTTCCTTGTCGTTGTCTCTAGTGCACTGAAGCAGATCAGATCCTCTGACCAGCCTGTTCTACACGACTTTGACGA
GGAAAGCTTCGAGAAAGCCTTTGAACTCTTTAGACCTGGTGCGTTGTCTTTCAGCCATGACATTACCCGCTCAACCAACA
TTTGCTGAAACAGAACCATACAGTGATTCAAGGTCAGGTTGATGCGGATACCAAAGGGGGCTTGACTCAGGCAGAAATTT
CCAAGACGCTCGAATTTTGTTTCAAGGCCTTCGCACACGTCTCTTTTGATGAGAAAGAAGCGCTCATCAACAAGCTCAAA
GAACTTGGTCTTGATGGCGACGTGCACGACGAGAACAACCGCAAGGCTCTGGATGAATTGGAGAAGGAGCTGACGCCCGA
AGAGCGGGCTATCCTCACGACGCTGAAAGGGCGGCGGATGATTCGACCAGAAGATTCGCTCAACATCGACAACTTCACCC
TGGACTCGATCGACGGCCTCGCTCCTAGGTTGGAGCGTGGCAAGCTGGGTCTGGCTGCGGCCAAGAAGGCAGAAGTCAAG
TACACAACGCACGACAAGCTTTCGTATTTGAACGGTGAAGCCCGAGCCGCAAACAAACTCGGGAAAAACGATTACGCCGA
GCCCCAAGGAAACTCTATGACCAACGGGCACAAAGTGACAAATGGACACAACGGCGTCACGGAGTCCGGGCCCGACAACA
TGAATATAAACCATGTGGCTGACCTCGTGGCCTCGTGGAAACAGTCTAGCAAGACCGCTCTCGATGAGCTCACCAGACAT
GGCCTGATGTCGTCGTTGCACGAGGCCGCCGAGGAGCTCGAGACGCCCTACGACACCCTGACACGCCTTGTCAATGCTGT
AAGTTAAATTGAACGCAGAACTGGAAATGGCGCCACTCTTTCGTATCTGGTTACTGACAACATTCCCCTCAATAGGGTCG
CCAAGTCGCACTGGTCAAGCTTGGTGGCGATCTTGGCATCTTCAAGACTCTCGCGGAGAGCAAGACGCCACTCTCCTCGG
GCCAGCTTGCCGAGTACAGCATGGCTGAGCCACTCCTGGTAGCTCGCATTGTGCGCTATCTGGTTGCCAATCGTCTCGTT
TACGAGGTGGAGCCCGACCGCTACGTCGCCAGGAAGGCTACTTACGCCCTTGCTGACCCGCATATTGAGAGCTCCCTGCG
ATTCTTCCACACCGTCAGCAACCCCTCTTTCCAGGCTCTGCCAGACTACCTACGAGAGACGGGCTACCGGAATCAAACAG
CGGGATCTGCGCTCCAGAAAGGTCTGGCCGCTGAGCAAGGTCTCTTTCCCTGGCTGAAGGAGAACCCAGACGTGTTGGGT
GACTTTCAACATCTCATGAGCATTCCCAAAGAGGGCAACGGCTGGGATGTCATCCCGCTCGAGCTTTCCGTCAGCAGCAC
ACACCAAGGTCCGATGCTGGTGGATATTGGCGGCAACACTGGTCAACAGGCAAGGCTTCTGGTGGCCAAGCATCCCGAGC
TCGCCGGCCGAGTCATTGTCCAAGACCGCGAGGAGACCATCAAGAGCGCCCCGGAAGTCAAAGGCGTTCAGCTGATGGCA
CATGATTTCTTCGGACCTCAGCCCGTTAGGGGTAGGTAATACCAACACATTATAAGACGGCTCTTGGCTAACATTTCTCC
GCGCAAAATGAACAGGAGCAAGGTATTACTACCTCAGAGCAATTCTGCATAACTGGGATGAGGACCATGCAGTCCAAATC
CTCGCCAATATCGTGCCTGCCATGACGGCTGACTCGCTGGTACTGATTGACGAAGTGGTCATACCCAACAAAGGGGCTCA
CGTCTGGCCCGCCGGGCTGGACCTACAGATGCTAACCCTCTTTGGGGGTAGCGAGCGGACAGCTCTACAGTGGGACGCTA
TTCTCGAGAAAGCAGGGCTCAAGCCTGTCGTGGTCAAGAAATACGCACCTGTTATGGAGAGCTGTGTCATCTTTGCGGCG
CGGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62