GenePrediction:GLEAN_7189 Details

Name: GLEAN_7189
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3542204..3538855 (- strand)
Length: 3350
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3542204..3538956 (- strand)
Length: 3249
Type: CDS
Source: GLEAN
Position: GCSC_140:3538887..3538855 (- strand)
Length: 33
>GLEAN_7189 class=GenePrediction position=GCSC_140:3542204..3538855 (- strand)
ATGTCTTTCGGTTGGTCTGTAGGCGATCTCATCGCTGCCATCGATGTGGTCTGCAAAGTCGCCAATGCGCTCAGTGAAAC
CAATGGGTCTGCTGTTGAATTCCAAGAAACGATTCAATGGTTAAGCTCGGTAGGTAAGGTTCTTAAGCGATTGCAAGCTG
CCCCGAAAGCAGCTCCTGAGACGGACATAAAAACCATACTCGCCGCCGTGCTCGCATTCCAGAATGAGTTGATCAAAGAG
TATGGCGACACATTAGGACCTATGAGGCACTCTGGTGTGATGCAGGGCGCCAAGCGGAAGTACGACATGGTGAGATATCG
GATGACTGTGAAGGACAAGGTGAAGGTTCTGCGGAAAAAGGTTCAAGCTTCCCTTGACGTGCTCGACATGAATCTGGGTA
TTGATATCCACGCAACGGTTAAGGATACGAACGAAGTGACGCGTTCTATGCAAAATGTTCTGAAGAGCGACAAAGAAAAG
AAAGAAAAGGAAGACCGCGAAATTGCGCTGGCAAAGGTTTCAAAATGGCTGAATCCGGTTGTGGCAACGAGGGATAGGTT
TGACGAGCGCTCGGAAACCAACGTGGTTGGATCGGGACAATGGCTTCTGCACACGGAGGCATACCAAAAGTGGATATCGT
CACTCAGTGCGAACGGGCAGGAAACGAACGAGCAAAATGAATATGATGCAGCCAGACGATTACTATGGATCACGGGCATT
CCAGGCTCAGGCAAGACGAGCCTGGCCACGAGTTTGGTACAGGAGTTTGGGAAGGCCACTCGAGGGAAAATGTTTAAAAC
GGCCTATTTCTATTGCGAGACCCGCGAGCAAAAAACGACAACGCTTCGTGCCATCCTGCGTACATGGACGTGGCAGCTGA
TGCAACAGTGCACATGGGATGCAGAAGGCTTGGCTGAACTCACAAAGGCCCGGATGTCCGAGCCCGATCCTGGTTTGTTC
ACCCTCAAGAAAATTCTGGTAGATCTCATTCGCCGGGAAAAGGACGTGGTCTTGGTTCTCGATGGACTGGACGAATGCGC
TGAGAACGACCGCAAGAAATTCATCACCGGGGTGCTGCCCATCTTGCTTCAGAACGCGCCCTGTGCCATCTTCAGCCGTC
TGTCCAACAACCTTGTTCAGCTCGTGGATGGGGCGCTGCCTAAAACGTACCAACAGCTTCACATCAGCCCTGCAGATACG
GCAGGGGATATGCGCAAGTTCTCTGCGCAGGAAATTGGGACTTTGAAGAAAACGTCTGCAGAGATGCAGAAGGAACTTAT
GCACGCTTTTGAGCGACGCGCCAATGGTATGTTTCTGTGGGTAGAGCTTATGGTTCGCACTCTTCAGGACTGTCTACTGG
AGGATTACGTTTCCGAGATTGAGGAGGCTCCAGTTCAGCTGAACGATGTGTACCGCAGCATACTGGGGGACATTTGGAGT
CGGTCACAGAGCGTGCGCAGACACTCAAAGTTCATTCTGCGGTTGCTGACATGTGCGGCGCGACCATTGTCTTTGAAGGA
GATCTCGACTGCCCTTCAGGTAACGGTCGATGAGCCTACGTTTCGTTACGGGAAGAGCAACGACGGCAGCATTTTGAGCG
TGCCAGAACTGCTTGGGTTCTGCGGCTCGATGGTTACCGTAACGAGCAACACAACCGATCCCATAGTGTCGTTGGTTCAT
GAGTCGGCCAGGGAATATCTGGCCGATCCCGACAATCGAGGACAGATCTTCGGCGATCTCATTGTGGACGAACAAGAGAC
CCATGGACTGATGGCACGCATATGCCTCACGTATCTGTGCTACAACAACGTGCCTGCGTTTCCCTACGAAGCCGACCTTC
TCCCAGGAGAACCTCGCCAAACCGATCGAGCGCCTCTCCAGAGGACTGCTGATGCCTATTTGGATCGAATCATGCTGCAA
CGTTATGCGACGACGCAGTGGGCCTGGCACGTGTTGGCGTCGGAAAGTCCTTTGAGCCACGATACAACGGCATCGCTGCT
GCGACTCTGCCGCTCTGAAGAAAGCACGATTCGATGGGCGCAGACGGCTCTGTTTGTGCTGATCGACCGTGCAAGCATAA
CTGGACGTGGCACGCAGGACGACTCCAAGCTGCTGGCGCCGATTTGCGAGCGCATTTTTGACGAGCCGGCCAGGCGAGAG
TATGCAGACTGGCTTTCCCATCTGACGGGGAACCGAGCCGAGCGCACATTTTCGCGGTGGACACGGCTCATGATGCCAGG
AGACGGTGATATTTTCCCGTCCGATGTGCATGTGGCAGCGCATTTCGACTTTCTGGACTACTTGCGCAACTACCTCGAAG
CTGGCGGAGATCCCAACCGGAAGACCGTCACGGGAAACACGCCTTTGCACGCCTGTGCCCACTGTGAAACGGTGGCCAGT
GCAGAGCTTCTTTTGAAGCATAAAGCCGACCCGAACGTGCAGGGTTTCGCTGGGATCGATGCGATGGCCTGGGGCATGGG
CATCACTCCGCCCAATGACATCCACACGGGGCACTTTTCCGTGGCCGAAGTTCTGCTCAAGGCCGGTGCGGACCCGTTTT
CCGGCCCCTTCGATGAGCATAGTACCTTTTGCCGCGCGATGGTCATGGCTCTGACCGACTTGCCGCCCTACAGCGACGGC
CGTCGGCGGTTGGTCGCTGACGACCCTTGGGTACTGGATCTGTTTACGAAAATGATGGAGACGAACACCGTCCAACGACA
GGCAAGACTGCAACAGGTCGTAGACAGAAAATGGATGCTGTCAGAGGTCATAAGAAAGGGTGCCTTGCCATTGGCGCATT
TCTTAATATTCCATGGAGCCAATATCAGTCTTATCGATCCCGAGGATAAAGCTGTACTTGACGTAGGCCAAGTGGCTAGA
GTCGATGGTGCAGGAACACTGCCGGGCAGCTTGGAAGGAAAGCTGGTATCGAAAATTCGCACTTATGCAAATAGTATGGA
CGACAGCGACAACAGCCTCGACAACGACAGAAAGTACTGGCCAGAGACAGCCGACGATGTGTTTCGGGCATACCTGGTAC
TGCAATCAATGCTCCGAGCGTCTCGGCAGTCTTCATCGCAGCCACGCGTGGCTATCCACACAATTATCGTCCATATTTTG
AACACCGCCGGATATTGGCTGAAACTGACGGCGTCCCGTGAGGAGCCGCAGTCTTACAACCAAGACCGCAGCCAGATAGA
TCCTGTCTATCTGACTACTCCGCCCCTTCTGGGACGAAAGCTGCGGCCCGTATGCAAGATCTGCTTCTACCTGTCCAGTA
AAGACCAAGGACATGCTGATATCAATATGAAAAGCAGCTACGATCAGTCATACACATGGTTTTCGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62