GenePrediction:GLEAN_7193 Details

Name: GLEAN_7193
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3526922..3525539 (- strand)
Length: 1384
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3526922..3526785 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_140:3526715..3526438 (- strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_140:3526336..3526154 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_140:3526077..3525732 (- strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_140:3525676..3525539 (- strand)
Length: 138
>GLEAN_7193 class=GenePrediction position=GCSC_140:3526922..3525539 (- strand)
ATGGTTTCAGGCTCTAGGTTTGTGTCCGACAAGTCAGCCGTGATCTTGACCCTGGTCTTTGCCACGGCCGTCTTCAACGA
CTGCACTCAGGGCTACGACCAGTCTTCCATGAACAACATGAACCTCGTCAACACATATGTCAGCTGTACATTCCCGTCTC
CTATCGTTTCCTAGATGAGAAATATCGTGCTGACTCATCATCTACAGACTTTCATCTTGGGGATAAATTTGCTGGGCCTC
AACGTCGCCATCATCAACGCAGGCTCCGTCATTGGTGGCCTCTCTGCCGACCAGGTGTGTGATCGCTGGGGCCGCAAGGC
TGGCATAATCCAGGCCGCTGCCGTCCATGAGGCCATGTTCTGCATCGGTCGCTTCTTCCTCGGCGCGGCCGTCACCTTGA
ACGGCGTTTCTGCGCCCACATGGGTCATGGATATTGCCCATCCCAAGACGCGCGGCCTTTTGGGCGACCTCTACATGGCC
ATCTGGTAAATTATCGCCACCATCGTCTCGGGCATTCCATCGGTACGTACTTTTACAACACCACGTGGACGTGGCGTGGC
CTCTCTATCGGCCAGGCCGTGCCGAGCCTCCTCGCCCTGAGCCTGCTGCCCTTCACGCCCGAGTCACCCCTCTTCGCCCT
GAGCCTGCTGCCCTTCACGCCCGAGTCACCCCTCTGGCTCGTCTCTCAGGACCGCCATGAGGAGGCCCTGCAGCTGCTGG
CCGTCCTGCACGGCAACGGCGACGCCGACAACAGCTTCGTGCAGGCCGAGTGCCACGAGATATCATCTGTGCTGGCCTAC
GAGCAGACGCTGCCGTCCCAGTCGTTCAAGTCTCTTATCAGTCAGTCCGCTGCCCAACTTCCGCCGCTTCGGCATCGTTA
TCGTCCTCAATATTGCCGCCCAGGTGATCGGCTCCAACATTGTCTCCTCGTACATCGGCAACGTCCTCGACTCGGCTGGC
ATTACCAATACCCGCCAGCAGCTGATTACTAATATCGGCATGATCATCTTCAACTTTGGCTGCGCCATCGCCGGGCCCTT
CGCCATGGACTACATGGGCCGCAAGGGAATGCTGCTCGGCGCCAGCTGCCTCATGACCGTCCTGTCGGCTTTGTACGGCG
ATGGGAGCAACAAGGCCGCTAGCAATGGCATGATGGCCATCATATTTCTCTTCCTGGGCTCGTACAGCTTCGTATGGACA
CCGCTCACGTTTGTCTACCCGGTCAAGGTTTTTGAACTTTACTCAGCGCGCCAAAGGCTTGGCTGTTGGACAAATGGCCT
GCTATGCGTTCATGCTCGTCAGCCAGTACACAACACCTATTGCCATGAACAATATCGACTGGGAAGAAAAGAATAAGGCC
GTCTTCAACAGGGCTCGCCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62