GenePrediction:GLEAN_7194 Details

Name: GLEAN_7194
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3524637..3522969 (- strand)
Length: 1669
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3524637..3523967 (- strand)
Length: 671
Type: CDS
Source: GLEAN
Position: GCSC_140:3523881..3523646 (- strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_140:3523564..3522969 (- strand)
Length: 596
>GLEAN_7194 class=GenePrediction position=GCSC_140:3524637..3522969 (- strand)
ATGACGCTCATTCGCGTCCCCGCCGGCTCCGGGGCCCCCGGAGACCTTCGTGCCATCCGATTACTGATAATTCCCGTGTT
CAATATGCACGACCCATCGCACCAGCCACGTCAGCTCTCCATTGTCATGACATTCGCATCACCGCGTCTTAGCCGGCATG
ACGTGCTTGTTACCCTACCGAAGATGATTGGGAATGTGCCCAGCCAACAGTATGGCAAAGACTCGCTCCAGGCTTTCGAT
AACATGGGCATGCTTGAGCTTGCCGTCTCGGACGCTACTAATGAGCGCGTGTGGTTCGTCAAGAGAGCGACGTGTGGGGA
CGTAAGCCTTCAGTTTAATGCCCTTCCCCGTCCTGTTGATGCGGATACGCCCCCCGGCCCCCGGGTCGATCTTCGAGAGC
AGTTTGGCGGTATTCTAGGCGTTGGTTCAAGCTTTCTGCCTTTGCCGCCAAATCGAAACTCAGACGCGCAATACGAGTCC
ACGATTGAATGGGACCTCGGTCAGTCACCATATGGGACGCGGACAGTCTGTTCGTTTGGAGAGGGAACTGGTCCTATCCG
TAGAAAGGGCAGTCCCAGTCTTCTTCGGGACCCCGTCTTCGGTGTCGGGCCACTCCGACGCCTTGTGAACAATGACAAAA
CCCCTTCGGGTGCCCTTTTCAATGTCTTCTGGTTTGGCAACCCTGCATTCGATGTTCAAAAGTTAGGCAGAGACACCCAG
AAACTGTTCACCAAGATGTCTGTTTTTTGGCGAAAGCGCCTCTGAGGCGGATCCCTATCGTATTTTCCTGCGAGAAACTC
CACGAGGAAATGGCGGCACGGCCTTCCGACGAAGCTTTATGTTTGAATACGACAAGGACATTCTGCGTCTCGAGCGGTTT
GTTTTCCCAGTTCTTGCGCATGAGATGGTCCACAACTGGCCTCTCCTTAACAAGGAATCAGATGGGTCGAACGATGACCT
GGATACGGGTGACGAAAACTGGTACTCTGAGGGTCAGTTATGTTCATATACGAGAAACGAACACGAACAGGATTCTGCTA
ATCGCTTGCATAGGCATTGCAATCTATCACCAGATGATGCTGCCGCACGATTTGGTCTGCGCAACAAGAAGTATCTTCTC
GGAGAGCTGAACTCGTATTTGAGTGGTTACTACACGAACCCTGTCATAAAGATGACCAATGAAGAGGCTACAAGACGGTC
CTGGGAAGAGCCTAACGCTTTGAGGCTACGATACAGCCGAGGTTTCACGTATCTCTTGAAGGTAGGCGCGCAGGTGTGGG
AAAAGACTGCCGGGAGGACTTCGATAGACAGCATCGTGTACGAGCTGTTGGAGAGAAAACGGAGAGGGAAGTCGCACATG
TTGCAGGACTGGCTGATTATAATCGAGCGCGAACTCGGTCACACCGGAGTTGACGAGTACCACGATATGGCGAACGGAGT
TCTTGTCGTTCCTCCGGCCGATTTTCCGCCTGCGAAGTACAAAATGAAGCTGGTTCGACAAGATCAGGAGGTGCTGGAGT
TTGTGTTCAGTCAAGACTCTATCAACACTCGAAGAATCCGAGGGCTCAAGCCGGGTAGCAGGGCTGACCAGGCCGGCCTG
AAGGAGGGCGACAAGATCCTGGAGAGCAGTTTTTTTATTGGGAAGCCGGCGACGACATTGAGGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62