GenePrediction:GLEAN_7196 Details

Name: GLEAN_7196
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3518704..3516784 (- strand)
Length: 1921
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3518704..3518685 (- strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_140:3518620..3518377 (- strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_140:3518320..3517868 (- strand)
Length: 453
Type: CDS
Source: GLEAN
Position: GCSC_140:3517809..3516784 (- strand)
Length: 1026
>GLEAN_7196 class=GenePrediction position=GCSC_140:3518704..3516784 (- strand)
ATGGCTGCAGCTGAAGCACAGTGAGAATAACCCGTACTATATCTCCTATAACGGATGGGAAACGCAAAACTGACGGCCCC
ACAGAAACGGGCTCTCGCGCGAGGGCTTCGACAAGATCGTGGCCTCGTTTGGGCTGACGATGAAGAGCGACGATGCGGAT
GGGTACTACAAGCTGATGCAGGAGCTGGACGACGAAGTCCGCACGATCGAAGGACTGCCAGACTACGTGGATCCGCGTCT
GAAGCCGAGCGAAGCGGTGCCGCTATCGGGACGAAAGTACCATGTGCCGGACAAGCAAGACAACCGGCTGAACGGCTGGA
GTCACCGGGTGAGTGCACTCTGGATGCGGTTCCTTGCTGCTCGTCTTGCTGGTCGCACTAACAGGGGGGGCAGTTCGAGC
TCAAGGACGAAGCTGCCGTGGCCAACGGCCTGTTAGCGGGCCGTTCGGTCGCGGTCAAGGACACGATCGCGGTGGCAGGT
GTGCCTCTGACGTTGGGCACGGCGCCATTTCACCTCTGCGCCAACGCGCCGTATCCGATCCCGACGATCGACGCGCCAGT
GATCAGCCGTGTGGTGGCGGCTGGCGGTGTGATCAAGGGCACGTCGACGTGCGAGAACTACTGCATGTCGGGGCTGTCGT
TTACGAGTGCGACGGGCCCGGTCGAAAACGCCTGGCTGCGTGGCTACTCGGCGGGTGGCAGCAGCAGCGGTTCGGCTGCC
CTATTGGCCATCGGCCAGGTCCAGGCCTGGCGTGAGAAGCGAGGACTGCCGGTCGAGGATCTGGGTGAGGGGGTCGATCT
GGCTCTGGGAGGCGACCAGGGTGGCAGCATCCGGCTGGTGAGTGTCGTCTGTCCGTCTATCCGTCTACTGTGTCCTCTGC
TTCACTGACAGTCAGCCTGCGGCCTATTCCGGCGTCTACGGCCTCAAGCCGACGCGTGGCCTCGTTCCCTACACCGGCAT
CGGCGCTTTGCACCCGCTCGCCGACAATGTTGGACCCATGGCGACATCGCTCGCTGACGTAGCCCTGCTGCTGTCGGCCA
TTGCCGGCTACGACGGTCTGGATCCGCGCTGCAGCCCACATACACCATTACAGCGGCAAGATGTGCCGGCCTACCACGAG
CAGCTGCAGGCAGCCATTGCCAACCGCCAGGCCCGTGGCCTCTGGACTCCGTCGACGGCCGGCCGTGGTCTGCGAGTCGG
CCTCCTGCGCGAGGCTCTGCAGAGGCCCGAGCTGGACGCTGGCGTCGCCGCTGTGGTGCGTGCGGCTGCTGACCGGTTTG
CTGGCCTCGGCGCCACCGTCGTCGACGTATCAGCACCCCTGCATGCCCACGGCCCGGCTATCTGGACGGTCACGATGCGC
GACACCGCTGCTGACGTCTTCATCGCCGGCCAGGCGCCCGATCAGCTCTCGCTGCCCATCCCCGGCTTCGCCCCCCCGCC
ACCCTCCCAGCAATGGTACGACGCGATGACGACAGCAGCACCCACCGTCGTCGCCGGCCTCTTTGGCAGTGCCTACCTCG
GCGACCGCTCTCGCTTCCCCGTGCGTGTTCGCAACAAGGCCCTCGCTCATGCTGTCCAGCTGGCCGCCTCCTACGATGCC
CTCCTCTCGTCCGAGGCCGGCGGCGTCGACGTCCTCCTGCTGCCTGTCACCCCCTCCGTTGGCCCTCGCCACAGCGAGAT
GGCCGGCAAGAGCGTCCTCGAACGCTATCGTGCCGCCCTCGGCGTCTCCGGCAACACCGCCCCCTTCAACGTCTCCGGCC
ATCCTGCCTTGTCTATGCCCGGTGGCTGGGCCACAGTCGAGGACGGCCACGGGAAGCTGCCTGTTGGCTTACAGATTGTT
GGCCGGCACGGAGACGAGGTCGGTGTTCTGCTGGCCGCGTCCATCCTCGAGGTCGCTGGACTCGGCTTGGATATTGAATG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62