GenePrediction:GLEAN_7197 Details

Name: GLEAN_7197
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3513402..3512890 (- strand)
Length: 513
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3513402..3513364 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_140:3513063..3512890 (- strand)
Length: 174
>GLEAN_7197 class=GenePrediction position=GCSC_140:3513402..3512890 (- strand)
ATGCTTCTCGAAGACGAAGAGCCTCACGTGATACATCACGTAAGCAGAAGTCCCTCGACCGATATGTATGGAGTACGGAG
TATCTTACGATACGTTCGCAGTGCCGGGTTTTGCAAAGCCTTTTCCAGGCTCCTTACGATATAAAAACATTAACTCCGTA
CTACGTCGTATGTAGGGTCGTCGAGCGAGGTGGGGTTGGTTGCATGTGTTTCCCTACCTTATTTTTCCGGTTGTGCCAGT
AAGATCTCGTTATTATAGGGGCGCCACTCCGAATCAGGGCCTGTCTCAACGTCTCCGCTCCGCCAAAATTCGCCACTTCA
GCCGCTACATACTCCGTAGAAATCTGGTCGCTGGCTACGATCGATTGCAAGGGTTGTCCACCGAGCCGAAGAGATCGAGG
ACGAGGCCGACGTCGTTGGCCAGTCTGTAGCCTGGTCTTACGACTACGATGACGGGGAGGCGTCCGGCAAATCCATGTAC
CCCAGGACGCCTGCAGGCTGGGAGAGGGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62