GenePrediction:GLEAN_7198 Details

Name: GLEAN_7198
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3510800..3505860 (- strand)
Length: 4941
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3510800..3510565 (- strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_140:3510396..3509058 (- strand)
Length: 1339
Type: CDS
Source: GLEAN
Position: GCSC_140:3508705..3506137 (- strand)
Length: 2569
Type: CDS
Source: GLEAN
Position: GCSC_140:3506047..3505860 (- strand)
Length: 188
>GLEAN_7198 class=GenePrediction position=GCSC_140:3510800..3505860 (- strand)
ATGACCTCGCCGCACATCGAGTTTGCCTCAACCGCCGTTGCGAATCCTCCTCTGCACGCCGCCTCTGCCGGATCCACCGT
GTCTGCACCCCTGCCGCCCACTTCTTTGCCGATCGTGGTCCCTGAATCTGCGCTCGACGCCTCACAGCAGCCCAGAGCCT
ACGAGTACGAGTACGAGCACTCCTACAGCATCCCTTCGCGCCCCGACGTTTCCGCCTTTCCTGCCGCCCTCCCCCCGTCT
TCCACCAGCAGCAGCGGCTTCGACTACGGCGATCTCGGCGACTACGGAAACGTCCGCAGCAGCAACAACAGCAACGTGAG
CAACGTGAGCAACGTGAGCAACGCGAGTATCGTCAGCAACGTGAGCAACACGAGTATCACCAGCCGGCCTACCACGACCA
ACAGCGACCGTGTCGAGTCAGCATCTGCTACCCCCGCTGCCACAGCCTTCTTCGCATTGGGGTCCCCTTCGACCAGTCAG
AGGCCGCAGCCGCAGCCGCAGGCCCAGACGCAGACGCAGCTGGGACCAAGGCACAAGCAGAAGCCCTTCTCTGCCGCCTT
TCTGCCACGATCCTCCTCTCTCCTCCCCGCTGTTCGGCTCGGCCGAACCGGCCTGTCTGCCGGCACCGCCGCCGCGTCTT
CTCCGCTCTTACTGCGGCCCCTGGTCCATGCGCCCGCGACGCTCTCCTTCTCTGCCATTGCTGAACCTGAGAAGGACGAG
GACGACACTGCAGCACCACCACCACCACCACCACAGACCGTCCCCTTGCGCGACACTCGGCACTCGCGCTCCAGCAGCGT
CGGCGGCGGCTCCGACAACCTGCGCAGTCTCTACCGTTGGTCCTCGTCTACCGGCTCGAGTCGTCTCTCGCTGTCAGCCG
GCCACTCGCTCGTCTACCGCCACCAAAAGTCTGCCAGCTTCAGTCGTCGTCTCAGCGTCGAATCCACCGGCCGTCTCGGC
GACACCACCGATTCACCGCCTCCGCCGCCGGCGCCGCCAAAGGACCGCGAGCCGACCCCGCGCAAACTGCAGAAGAGCTG
TCCCGGCACGGCAGACGCGCCCACACCCATCCACGAGGAGTTCTCGTCAGCCCAGTCACCGTCGCGCGTCAGCTACCGCC
AACAGGCCTCCCCACCGCGCTTTCTCCCTCCCATCATCGCCCTGCCGTCGCTCGAGCAGGAGGTACAGAACGGAGCCACT
GGCTCGCTGTCTGACCTGATGGCTTCTCCACAGCATCGCCGGCCGCCTCATCTTCGCCAGCTCAGCTCCGAAGACAACAT
CAAGTCCTTTTACTTTGGCGACGCGCTTGCCTCTGCCACCTACACCGGCCGATCCACGCCTGCTCACCAGATTATCGAGA
ACCCGGAGTCCCCCATCCGCTCCCGGTCGCGCGCTGGCATGGACGGTATGTATGGCCGCGAGTCTGAAGCTGCTGCCGCA
CGGGCGCAGGCTCAGGCGCAGGCCCAAATACAGGCGCAGGACCAGGCCCAGACGTACGGTCGGAGCCGATCGCGAACCAA
GGGAAGCATGGACTCCAGCAGGAGCAGGGACCGGGCGAACAAGCCGCCGTCTCAGAAAGCCATGCTGTCGCGTGCCCTCC
AAAAGGCCAACGCCGCCGTGCAGCTCGACAATGCCGGCAACATTGAGGGCGCGCGCGAAGCTTACGCCGAGGCTTGCCGA
CTCCTGCACCACGTTCTGCTCAAGACACAAGGCGAAGAGGACAAGCGCAAACTGGAGGCAATTGTATGTTACATGGCAGA
GAGCTGCATTGACCCACCCCCAGTTACTCATATTGTATTAACCGCAGCAGAGAGTGACATACACGGCCCGAATAGAAGAG
CTCAATCAGCTCGCCCCTACACAGGTGCTAGATACGCGTCCCCTTCCAAAACGACCACAGAGTAGCGCAGCTCGCAATAT
AAACAGCGCAATCAGCGACGACGACGACGGATCCGAGGATGACGGCGATGACGACAACGACGACGACAACATGGTATACG
GGCGTCATGCCACCGAGGCAGCCCGGGCAGACGAAGTGGTATCCCGTTCTGCAGACTACTATTCGACCCCAGTGACAGCA
TCGCCGAGGTTGCAGCCGTCGGCCTTCAGTGCCAGCTACGATAGTTCGAAGCATGGCGACACGCTGCTGAGCGACCAGTA
CACCTTGCAGTCCTCCTTCTCGCGCTCGCCGAGGAGAGAATTCCACAGGCCCAGTGTCATCAACACGACTGCGTTCAACA
GTTCCCTTCAGCCTCCGATGGACGTAGCCTCCCCATACATGCCCCCACCACTGTCCCCTCGACGGATACCACCAACGACG
ACGGCTGGAATGGCCCATCCGCCACCGTCAGCGCCTGTCTTTGGCGAGCCGAAGTGGCTGGTGCCAGAGTACAGCTCAGA
ATCAAAATCCTTTAGCAACCATGCCAGGTCGACGAGCCACGAATCGATTTCGTGGTTGGACCCGATCGACGAGTCTGGCG
GGTCAGCCGCATCGTCCGTACACTCTCGATCCTCGTCCAGGATAATACGGAAGCATATCCGAGCGACCAGCGGAGCGACA
GAAGCCGAGTTCGACGCAGCCCTGGATGACGCCATCGAGGCGGCATACGACGACGGATACGATCCGATGAGCCCCGGGAC
GTCAGACGCGAACGAGTATGGCAATGGCTATCTGGCAGACGCCGCACGAAAGGCCGAGCTGGCACGAGAGCGCATGCGCG
AGGCCGAACTGGAGGCCATGCGCTTCGACCGCCAAATGCGGGAGCAGCAGCGTCGGCAGCAGGATGAGGAGATGGCAGAA
CGCACGAGGCACAATTTCCTCGACCCGGCAGACGACTCGGACGAAGAGGAGCGGATTCTGGAAGAGATGACCAATGGCTA
TGCGATAGAAGACTTTGCGTTTGGATCCGACGTCAATGGGAAGCCGAACTCGCACGAGTCCGAAGGGGTAGAGCCGACAA
ACAAGACGGTGCTGGCGACGGTGACGGAGAACACGGTTTCCATGCCGGCGGTCGTGTCGGCAACCAAGGGGGGTTATCCC
GGTACAATGCAGCCGCCGCCGACACAGGCGCTGCCGAAATTGCCGCCGCAGGCATTGGCTTCCCGTCTCACGCCGACGCA
AAGCCCCCGATCGGAACAGACGGTGCGGAACCGGCGTCTTTCTGGCCAGAGCATGACGCAGCTGAAGATCGACACGTCTT
CGCCAGGTGTGAAAACCGGGATGCGACAGCCGGCCACGACGACGGGTGCTCCGCCCTCAATGATGTCAGCCGGTCCGACG
GCTGTGCCACAGGCAACGGTGCGAACTGCCGGCTTTCTTGCGCAGCAGAGACAAGTGTTGTCTGCAGTGACGATGCGGCC
TGGCTCTCGACAGGCACCGGTGGCGCCCGGCGACGGAACAGTGCAGTCCGGCTTCCTGCCACCCACACCACCGATACCGC
AAGGGACGACGTTTGCGGACGTAGACAGTACGACGGGCCGGACAGGCTCGCCTTCGATTGGCAACGGCAGGCCGGCGCTG
CGAAAGAACTTCTCGTCGTCTAGCCTGAGGAGCATGCGCGGTCGCAACATATCGGTGAGCAATCTGGAGGACGGATTGGA
CATGTCGCCAGGCACGCCATTGAGCAGCCATTTTGCGCTGAACGGCCGGCTGCCAGCGCTGCCAAGCCTGCCGTCCTCAA
GCCTGGCTACGCCGCTCGTGGCGGCGCTCAAGGAGCGGATGGCGATAGGGACGAGCAGCGGGACGGGTGGGATGTCGCTG
CTAGAGGGCGATTTCCACTCGCCGAGCACGCCGGGGTCGCCAAACATGGTATTCTCGGACGCGCCGGCACCATTGGAACC
GTGTCCGACGGACTCGATGCTGCGGCCGTTCTGGCTGATGCGGTGTCTGTTCCAGACGCTGGCACACCCACGCGGCGGCT
ACCTTAGCAACCGGCTGTTTGTGCCGAGCGACGTGTGGCGGGTCAAGGGCGTGAAGCTGAAGAACGTGGACGAAAAGATT
TTGAACTGCGACCTACTGACGGCAGCGCTGCTGAAGCTGGCGCGGGTGGACACGTTTGACGCAGACGCGATGCTGGTGGA
GATGCAGTCGTTTGAGACGGTGCTGGAGCAGGTGCAGGCGACGCTGACACGGCGGCTAGGCAGCGAGGTGGGCGTGCACA
GCAGCAGCGTCATGTTCAAGGACGCGTCGATGGTCCGGGACGGCGATGCGGGCGGTAGTTTTGGCGGTGGCGTTGGCAGC
AGCGGCGGCGGCGGAATGGGATCGAACGGCGGGACAGGCTCGGGATTGGGGTTGGGGTTGGGCATGGGCCTCGGAGCAGT
GCCGCGAGCAGCCAGCGTGACGGGCAGCCGGTCGTTTTCCTGGCGACGGCTGCGGTCGAAGAACTCGGCGGCAGCGCTGG
GCGGCAGCTACACGTCGACGAGCGGACGCAAGGAGAGTCTCTCGGGCGCGTCTGGGACAGCGGCGAAAGAGGGCGGCAGC
AATGGTCTTGGTGGAGGAGGCAGCAGTGGCGGCGGAGCCTCGACGACGCTGTCCTCACTGCCGATGACGCAGAACCCGAC
GAGCAAACCGGTGCGCCGCGATCTGGCAGCGGCCAAGTTTGCAGGTCCATACGCGCATTATGCTGCATCTCTGGCACGCT
TGTTTGACGCTGCTCAGTCGATTGGTCAGTTTATTTGTGTGTTGCGTTTGTGTATCGTGTTTGCTGTTTCTACGTTCTTC
TTTTATGTGCTTTTCCCCTGCTAACGCTCCCAGACCAAATTGCCCGCCAGGTGGAAGACCCCGGCCTCCGTCACGCCGAC
AAGACGCAGGTCGGACTGGAACTCTGCACGCGCAACGCAGCCGAGTTCTTTGCCTTTTACATCTGTCGCTTCGTTCTCTC
GGACGTGTCCTTGCTGATGGATAAGTTTGTCAAGCGGGGCAGCGAGTGGGTGCTGACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62