GenePrediction:GLEAN_7201 Details

Name: GLEAN_7201
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3495330..3494218 (- strand)
Length: 1113
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3495330..3494821 (- strand)
Length: 510
Type: CDS
Source: GLEAN
Position: GCSC_140:3494730..3494697 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_140:3494626..3494618 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_140:3494550..3494450 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_140:3494379..3494218 (- strand)
Length: 162
>GLEAN_7201 class=GenePrediction position=GCSC_140:3495330..3494218 (- strand)
ATGCTGCACCTCAACCGCCCCACCAGCTTTTTCTGCCGTTTCCCACCGCCCGCTGCCTTGGCCTGCGCAATTAATCGGTA
TCCTGGCCTTCGCTATAGCTTCCCTTGCCGTTCTTCGTTCTCCGTTTTCCGTTCTCCGTTCTCCGTTCTGCGTCCTCCGT
CCTCTCTGCCTGCATCACGCCGCATCTCGCCAAGCCGACTGCGCTCCGACGACGAAGCACGAAAGCCAATCCGGGCCGGC
TACAGCACCCAGGCCGACGCACGACCGCAATCGACAGGCCAGGCCTCTTCGAACAAGCTCTCGTCGCTCCCATTGACGCG
CCCATTTTCCCCCGAAACCCATCACAATGGTTCGTCCGTCCCGGTCTGGTCGGCTTGGCCGTCGCAGAGACAGCTCTGCG
TCTTCCAGCCACGGTGCATTGGCCCGCGATGGACGTCAGAAACGGCAGTTGTGGCTAACAGGCGTCTGCAGTCGGCCCAG
AACTCGACCGGCATCCAGACCCTGCTCGATGTATGATGCGTCCCCGAGTGTCCCCATTGGCCCGTCTCGACAACACCCAC
ACAGCCTGAACTGACCGTCTTAACCCCCATCTCTGTGCAGGCTGAGCAGAAAGCCGCCCAGATCGTGCAGAAAGGTGAGC
GTCCCCAAGGGCGGATTGTCCTGCAGTGGTCGAGCAGAAGCTAACCCAGACAACTGTGATGCAGCACGGGAATGTACGTT
CTCTACCAATGCGGCCTTGCCTGTTCACTACACACACACACACACCATGCTGACCAACAGTCCGCACCAAGCGCGTGAGA
GAGGCCCGTGACGAGGCCCGCAAGGAGATCGAGGCCTACAAGGCGTCCAAGGAGGCTGAGTTCAAGGAGTTTGAAGCTTC
CGTAAGCACCCCAAACCGTCTTTCTGGCCGTGTCCGGCTCGCTGTCCCTGCCTCTGCTAACAGCCCCGAAGCACACCGAG
GGCAACAAGGCGGCCGAGGAGGAGGCCAACCGCGCGGCTGACGCCAAGATCACGGAGATCCAGGAGGCTGGCAAGCTCAG
CCGGGACGATGTGATCAAGAATCTGCTGGCGGGCGTGCTGGAGGCCAAGGCCGTGCCGCCGTCCAAAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62