GenePrediction:GLEAN_7202 Details

Name: GLEAN_7202
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3491493..3490693 (- strand)
Length: 801
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3491493..3491463 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_140:3491408..3490693 (- strand)
Length: 716
>GLEAN_7202 class=GenePrediction position=GCSC_140:3491493..3490693 (- strand)
ATGCAGAGGCGCTGCACAACTTATCGGATACGTCTTTTCCTCCATCTTGCGCGTGACGACGCCATGCTCTCTTCCAGCTA
ACTAGTCTTCTTTCCTGCACACGACTGGGCTTTGCGCGACCCCGGCCTGACCGAACGGGGCTTCCAGCAGAGCCGCCAGC
TGGGCGCAGCGCTGCAGCAGGCGCTGCCGGGCCGCTTTGACGTGCAGCTGGTGCTGGTCAGTCCGATGCGCCGAACGCTG
CAGACGGCTGTCGAGGCGCTCGACTGGCTCGTCGGCCCATCAGCTGCGGCAGCCGTGCCCATCCGGGCGCATGCCGGCTG
GCAGGAAACCACGGAGCACGCGTGTGACATCGGCTCGGACACGGCAGTGCTGGCGCTCGACTTTCCCGGTGTGGACTTTG
CCGATGTCGATCCTGTCTTCCCCGACAAGACTTCGCCCCAGGCAAAGGCCTATGCATACTCACGACAGGCCCTGGTGACG
CGGGCACAGACGGTGCTCGAAGAGCTGCACGGTCGGCCTGAGGACGTCGTGCTCGTGGTGTCGCACTCGGCCTTTCTCAG
CCGGGCCGTGGCCGGCGCCATGTTTGGAAATGCGGACTACCGGATATTCTCGTTTGAGGACAGCGAGACGTCGGCCGACA
CGACGCCACGGCTGTGTCCACCACCGATGGCCGTGCCCGGATTGCCGCCTCTGCGATATCGACTGCGCGAGTGGGACGAG
ACACGGCAGAGCCACGGTGGCATGGGATGGAGCTACGACACGGTGCGGGCGATTGGTGAGGGGCTGCCTGATCGAGGATG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62