GenePrediction:GLEAN_7204 Details

Name: GLEAN_7204
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3480221..3478491 (- strand)
Length: 1731
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3480221..3480106 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_140:3480049..3479802 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_140:3479733..3479188 (- strand)
Length: 546
Type: CDS
Source: GLEAN
Position: GCSC_140:3479128..3478491 (- strand)
Length: 638
>GLEAN_7204 class=GenePrediction position=GCSC_140:3480221..3478491 (- strand)
ATGGGACTGTCCGACGGGCCCCGGCTGCTGTATGCAGCGGCAGCGATCCTGCTGGCGCTCGTGCTGCGCTCCGTCTTCAG
CACACCCGTCCTCCGGCGCCACGGCGTCCCTTTGAGGTGAGATTCACGGTGCATCGGGCTGGGTCATTGACGCTCTTTGG
CTGACGGTCCAGAAAACCGGCCGACACGCTGCCGCTGGCCGGCAATGGCATCCGCTTCCTGCAGGCGCGGCAGAAGCTCT
TCTCCTGGTTTGTGCGCTGCCAAGACCACTTTGGCTACGAAACCTATCAGATAGCCGTGCCGACTTTGCCGCCAGGCGTC
GTCATCAGCGATCCGCGCAATCTCGACTTCATCTTCAAGAGCGAGGGCACCCTCGTGAACAAGGGCAGCTTTGTCAAGGG
CATGCTGTGGGATCTATTTGGTATGTTGTCTCTTGTCGGCGACTACTTTTCATCCACCATTCTTTCTCACCCATACCTAA
CCTCACAGGCCATGGCATCGTCAACTCTGACGGCGACGTCTGGCGCGTTCAGCGACGCGCCGGCCAGAGCTTCCTCAACA
CGGCCAACATCCGCGTGCTCACCGACGTGGCCCTGCCGCAGTACCTGGCCGGCACGCTGGCCCGCCTGCGCGCTCTCGAC
ACCACGGCCGCTGTCGATCTCCAGGCCGTCTTCCACGAGCTGACGTCCTGCATCATGGGCAAGATGGCCTACAACATGGA
AATGCACGCCGAGGACGCCTTCTCTGTCGCCTTTGACCGTGCTTCAGCCGCCACCACGAAGCGCTTCCAGAACCCACTCT
GGCAGCTGACCGATCTGCTCTCTGGCAGCGGTGCCGATCTACGTCGCCAACTGGCCATTGTCCGGGCCTTTGGCCGTCGC
ATCGTCGCCAGCGCCGTGGCCGATCGAGCGGCTCAACTGGACCACGCCGACAACAAGCTGGACGAAGTCTCGGGCAGCCT
GATCCAGTCCCTGCTCGAGGCCATCCCAAACCAGGACATTGTCGCCGATGCCGCCCTCAATTATCTCTCTGCTGGTAAGC
CTCTCTTTGGAGACGACCCAATGTGAACCGTCATTGTCGCTAACCCGTAACAGGCAGAGACACTGTGGCTCAGGGCCTCA
CCTGGACGTTCTACATGCTCACGAAGCATCCCCGCGTCGTCGCCCAGATACGTCTCGAGATCGAGCAATTGCTTGCCAGC
AGCAACAACAGCCTCACCCTGTCTGCCCTCACGCCTGCCGCCCTGCCCTACGTCATGGCCGTCTTCTTCGAGGGCCTGCG
CCTGTATCCGCCCATCCCGTTTGAGATCAAGCAGGTCGAGACCGCCGCCGGCTTGACCCTGCCTGACGGAACCTTCTTGC
CCTGTGGTGCTCTCGTGCTCTGGTGCTCGTGGGCTATGAACCGGTCACGTCAGACCTGGGGCGACGATGCCGACGACTTC
CGGCCTGAGCGCTGGCTGGTTGAAACGCCCCATGAACAAGCTCGTCTCGTCGGCCGCAGCCCCTCCGAGTTTCCCGTCTT
CCATGGCGGCCCGCGCACTTGTCTGGGCAAGAAGATGGCCGAGTCCATGGCAGTGCAGATCATGGCCGCCGTCGTCTGGC
ATTTTGACGTGCAGCCCGACAGCAGCAGCAGCCCTGACCGCGTCACCAAGACCAGTCTGACCCTGCCCATGAACGACGGG
CTGCCGTGTATTGTGCGTGAGAGGGCCGTGTCAATGGTCATTGCGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62