GenePrediction:GLEAN_7207 Details

Name: GLEAN_7207
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3463960..3459314 (- strand)
Length: 4647
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3463960..3463712 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_140:3463660..3463568 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_140:3463514..3460229 (- strand)
Length: 3286
Type: CDS
Source: GLEAN
Position: GCSC_140:3459414..3459314 (- strand)
Length: 101
>GLEAN_7207 class=GenePrediction position=GCSC_140:3463960..3459314 (- strand)
ATGCATCAACAGGCTCGCCACCCGCCTCGCGGCTCATCGCCGGCTACCTCGCCCCAGACAAATCCCACACGCACCAACAA
TTCGAGAGACGCCCTCATCAGCCGCACACGCTCCTCCGAAGCCGCCCTGCCCGCCCCGTCGATAGACCCTGGCGGGGGCA
GCGATGCGGTCTCGCCGCCGTCTTCGGCCTCGCTTGCCGTCGGTGGCCCAACGCGGGAATCCATCAAGAAGCTGGACCAG
ATCATACAGGTACGCATTGAGACCTTGGACCCATCACACGTCCGTTGCTGACATGCACAGAACTTCTTTCTCAAGGCAGC
CGTGCTGATCGTCCAGGCTCGCATGCCCGTCACCCCATCGGGCAGCGGCCGTGGAAGAAAGACGAACAAATGGGTAGGTC
CCCTCTAGACGCTTCCTCCCCCCACATCCCTCTTCCTTTCTGACAGGCCCAGTTCCAAATCGAGACAGACGACATCGACG
ACTTCAAGGACGAGCTCCGCGTGTGGAAGCACTGTGGCAGCTTCGACTCGCGGCGCCAGCCCATGGTCATCGAGACGTAC
CTGGATGCCTCGCGGCTCGCTCCCGGTCAGGCCCTGGTGGTCATCGACGAGAACGGCAAGCGCTGGGACGCGCTGGAGGC
CCTCAACAGCTCCAACGTGTCGTCTGCCAGTGCCAGCAGCAACGGCAGCAACAGCAGCAACGGCAACACCAGTGTCGGCG
TCAGCGGCCGCTCCGACACCAACAAGATCCGCACCCGCTCGACCGAGATCATCCTCGAACGCTGGAAGGTCGAGCTGCAG
TCCATCCCGAGCCTGTCAAAGAGCAGCAGCACTGGTAGTGGAGGGCCTGCAGGGACAGCTGGCAGTGGTGGAGGTGGAGG
TGGCACAAACGCCTCTGCTGCCGCGTCTGCAGTTGCAGCTCTTCCTCCTGTCGACCTCGAGATGGACGACTTTGGTCCTA
TCCTACCTACCATCTACAAGCGCAGCATCGTCTTCTTCCGCTCGCTCTTCGTCACCACACACGTCCTGCCGGCCTACCGC
TTTTCCCGCCACGCCTCCACCAAGAGTGTCCATCCGGCTCTGGCTGTGCGCTGTCGCGTGCTCACCGGTGCCGATGCCGA
CGCTCGTATGAGCGCCACCGGCTTCGACAACCTCCGCCAGCCGCTCTTCTTTGACGGCGGCCGCGACCCTACCACCGACT
ACATGTTTGGCGATCTCGAGGTGCCCGTTGGCCGCTTTTCGGCCTCGGTCGCCTATCGCAACGACTGCAGCTTCCGCATC
GATGACTCCGAGTCCCTGCTCAGCTCTCGCTTCATGGGCATCGACGAGAACTACTTCCAGCCCTCGCTGCCGGCCCAGCA
GCAACAGCCACATCGTCCACATCACCGCCATCATCATCATCGTCAACAGCAAGTGCAAGTGCAGCAGCAGCAGCAGCAGC
AGCCACATCAGCAACAACAGCAACAACAGCAACATCCATACAACCAACAGTACCAGCACAACCAGGGCCTTGACCATTAC
CGGCGACACGATTCGTCCGAGATCGTCGGCTCACTGCCCTCCCGCCATCGACACGGCCGCACCACATCTGATCTGTCGTA
CCATCCACAGCCCCAGCAGACGTATGGCAGCCTGTCAACCTTCCACGGAGCCGGTGCTCTGGGCACAAGTCCCATCACAG
CCCTCAAGGCCGTGCGGACCATCGGCTCCGACACGAGCTCGCCCACCGACTCCATCCGTCCAAGCAGCAGCCTCGAGCGG
TCACCCCAGATCGAGCCACCACATTCGCTGCCCATCACTGCCGGCCGCCGCCACCACCACCACCACTCCTCTGGTGCTGG
TGCCGGCACGTCCTCAACATCCATCTCCTCGCGGCCAGCGGCCCTGCGAAACATGGAGGGCATCAGCCGGCGTCCGTCCG
TGTCGTTCCAGCCGTTCAAGGCCGGCTCGCTGTCCGGGTCGCCACGGACCACGTTGGAAGACCTCACCCTGCCGTCGTCG
CCGCTGTCGGGTTCGCGGCCGGCGTCTGGTCTTGTCGCTCTGGCCCAGGCACGCAACCGCAGCTCACTGACGGCAGGTAT
GGCCGCATCACTGCGCGGTGCGCCCCCGGTGTCGACGTCAGCCGGCAGCACCAGCACAGCGGCTGCCGCAGCGCTCATGA
TCGACCCGGGCCAGAGCCCGTCGCCGCGTCTCGGTGGAGGCGGCGGTAGCAGCCGTTACAGCAGCAGCTTCACACATCGG
CGCGGCCGGTCGTCCTTTGGTGGAGCCAGCCGTGCCGACGACGACCAGATGAGCAGCGGCAAGCAGAGCATGGCCTCATC
GATGGCACAGCCCGGATCAGGCCTGCTGGCCGAGGTGGCTGGCGGCGGCATTGGCATCGGCGGCACGAGTTCGGGCTCGT
TTCAAACCGACGACGACAACATCTCGGACTTTCTCAAGGCGCTCGAGAGCAAGAAGACGCTGCAGAGCTTCGAGCCCGGA
AACGCCGGTCGCCGCGGCCTCTCGGACTCGGCCCGTCGCACGGCCGCCCAGCTGTCGCGCTTCCAGCTGATGCGCGAATC
CAACGTGGCCCTGACCGACTCCATGAGCCTGTCGATGCAGCTGCCGGCACGGTCGCCGACCTCGGGCGTCTCCGGAGTCT
CGGGTGTGTTGGGCATCTCTCCAGGTGGTGGCATGTCGGTGTCCTTGTCGCCTATCAAGCCCATGTCACCTCACACTCCG
CACGTGCCGGCAGTGCCGTCTCGTCTGAGCGAGAACGCCATTATCGACTACCCGGGATATTCGAAGCCACCGCCACAGAA
CCTGCAGAGCCTACAGGAGAGCCTGCAGGGACAGGAGCAGGGGCAGCAGTCTAGCACGGTACGCATCACTGCAAGCTCGG
CCGAAAACGACGACGACGAGGCGGACGACGAGGACGACCATCGAGCGCGCACAGTCGGCAGGACGGGCAGAGGCTTGGCC
CGGACGGCCGCCAGCAGCACCGGCAGCGGAGCAGGGACCGGCACCACCGGAGCCAGGGACAGCACAACGGCCATTGACAT
TCCGCTCTCGCCACGGCTGCTCCAACACCATTCGGTTGACCGTCGGTCGAGCTCGACCGCCCAGAAGAAGCGTGCCACAC
TCGTCGGTAGTGATGGTGCCGGCGACGATGACGACGATGACGACGATGACGTGGCCGATCTGGCGGCCTTTGCCCAGCAG
CGACGCAGCCTCAGTGTCGGTGCTGGCATTAGCGCGACAGCAGCAGCGTCGGGAGCAGCAGCTCCTGGCGGAACAACCGA
GCCGGAAGCCGCGACAGCATCGACGGGTGGTGTGCCTGTTGAGGGTGCTGGTGCCGTCGGTTCTGGCATACCAGCCGGCG
TGCCATCTGGCTTGCCATCTGGCGTGCCAGCAGCCATTACGTCCTCAGCATCGTCTCTGTCGTCGGCCCTCCGATCAAGT
CCGGCCTCGGCCGTGGCCACGGGCACGGAACCACGCCGACGGTACACGAGCCGCCACCAGGTGCTGCTGAAGCAGGAGCA
CCGCAAGGAGGCCACCGCCGACAGCCTGGCCCTCAGTCTTGGTGGCAGCACCACCAGCGAGAAGCGGTCGACCACGACCC
TGGGCGTTGGAGGACGCTATGGACACGTTGGTGATGGCGAGGCCGACGATGAGCCGCTGGTGTTTGACCTCTCCGAGATT
GGCCGCGAGCCGTACCGACGCAGCCTCGAAGACGGCCGGGGTGCTGCTGGAGGTAACGGTGCCGGTAGCGGCAACAACAA
TGGCGGCAATAACAGCAACAGCAACAGCAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAGCGCCG
GCGGCAGCAGTGGTGGTGGTGGAGGCGGTGGTGGTAGCAGCAGCAACATCAGCCAGCACTACCAGCAGCATCACCACCGC
CATCACCGACACGACCGACCGGGCGGACATGCCGCATCGGAGTGGCGGACCTAGGTTTTGTCTTTCTATTCTGGCTGTCC
CATATGGCTCCATGGTGCTCTGTCGAAATCTCCACTTGTTTTACATTTGATCTTGTTTCTCTTTCTCTCGTGGCGTTCTC
GCATTCATCATTGTTTTCACTTCGATCTTCACCCTTTGCAAACAAATATAGACTGGCACATCCATCTTTCTAGACGGCCT
CCTCCCAGGTAGGCGGTCGTCAGGGGGTACAGGCAGGCAGGCAGGCAGGCGGTCATCAGGCGGGCAGACAGGACGGGCAA
GCAGTGACTGGTGGTTAGGGAGAATGGGGCACCGACTGCCCAGAGGGCAAACGGACGGGACCACACATGGAGAATGTCGC
GAGACGGGGCGTTTTTGCTTTTTTGCATTCTTTTTCGTGTTTTTTTTCGGTTTTTTCGGTTCTCGGTTTTCGTCTTTTCC
TTCTCCCTTGTCTTTCTCGTCTTGTTGTTTCCTCTTTTTCTATTGACTGCCTGCTCCTCCTTCTGACCGCTTCGTATGCT
TTCTTATGGACACCCATATCCTGTTTTACATACATGCCATGTTCTAGCTATCTGTGCTTTCTGTAGGCTCATCATCTTGG
GTATCTGTGGAGCACATGGGCAGCGACCGGGGAGAGGGCCATTGCGTGGACGGCTCACGGTTTGGAGCAGAACGAGAGAG
GTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62