GenePrediction:GLEAN_7208 Details

Name: GLEAN_7208
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3458737..3455065 (- strand)
Length: 3673
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3458737..3458654 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_140:3458586..3458419 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_140:3458341..3456002 (- strand)
Length: 2340
Type: CDS
Source: GLEAN
Position: GCSC_140:3455951..3455262 (- strand)
Length: 690
Type: CDS
Source: GLEAN
Position: GCSC_140:3455199..3455065 (- strand)
Length: 135
>GLEAN_7208 class=GenePrediction position=GCSC_140:3458737..3455065 (- strand)
ATGGCGCCGCGCGTGAGTGATGGCAACGAGACCGACGCGTCCATGCAGGATGCGCCGGCTGTGCGGCCACGCCAGTTTGA
AGAGGTAAGCCAGGATGAGGGATGAAGTGTGCGAGTTGTGCGAGTTGGTTGTGCTGACGGCCGCTGGAAAGGAAAACGAG
GATACACAAGACTACACCGATTCGGACACGAACCCCAACACGACGGCCAGCAGCGTGACCGGCGACCATGCGCCCGAGGG
CAGGAAGCGCCGGGACGAGGCGAGCCAGCTGCGCCGAAGCATCTTTGGGCGGAAACACGACCGTTTGGGCGAATCAAAGG
TGGGTAAAGAGAGAGGAGAGATTGAAGGAAGGAGAAGAAAGGAGACGATTTGATCTGACATGAATCCACTCTGTAGGAAG
ACGACACGATTCGTCGATTCCGGTATCTCCTCGGCTTGACCGACCTCTTCCGCCACTTTATCGAGACCAATCCGAACCCC
AAGGTGCGCGAAGTGGTCGAGGAGATCGACCGACAGAACGCGGCAGCAGCCAAGGGCCCCAGGGCGGCCCGCCAGGGTGG
CGCCAGCAGCGGACGGCAACGTCGCACGGAGGCTGAGGAGGACGCCGAGCTGCTCAAGGACGAGAAGCGCGGCGGGTCGG
CCGAGACGGTGTTCCGCGAGTCGCCGGCCTTCATTCAGGGCCTCATGCGCGACTACCAGGTGGCCGGACTCAACTGGCTC
ATCTCGCTGCACGAAAACGGCATATCGGGCATCCTGGCCGACGAGATGGGCCTGGGCAAGACGCTGCAGACGATCTCGTT
CCTCGGCTACCTGCGTCACATCATGGGCACCACGGGTCCACACCTGGTGATCGTGCCCAAGTCGACGCTGGACAACTGGA
AGCGCGAGTTTGCCAAGTGGACGCCCGAGGTGAACGTGCTGGTGCTGCAGGGCGCCAAAGAGGAGCGCCACACGCTCATC
GCGGAGCGGCTGGTGGACGAGAACTTTGACGTGTGCATCACGAGCTACGAGATGATCCTGCGCGAGAAGGCGCACCTGCG
CAAGTTCGCGTGGGAGTACATCATCATCGACGAGGCCCACCGGATCAAAAACGAGGAGTCGTCGCTGGCGCAGGTGATCC
GGCTGTTCAACTCGCGCAACCGGCTGCTGATCACAGGCACGCCGCTGCAGAACAACCTGCACGAGCTGTGGGCGCTGCTC
AACTTTCTGCTGCCCGACGTGTTTGGCGATGCGGAAGCGTTTGACCAGTGGTTCTCGGGCCAGGACCGGGACCAGGACAC
GGTGGTGCAGCAGCTGCACCGGGTGCTGCGGCCGTTCCTGCTGCGGCGGGTGAAGAGCGACGTGGAGAAGAGCCTGCTGC
CGAAGAAGGAGATGAACGTGTACGTGGGCATGTCGGATATGCAGGTCAAGTGGTACCAGAAGATCCTCGAGAAGGACATT
GACGCGGTGAACGGGGCAGGCGGCAAGCGCGAGTCCAAGACGCGGCTGCTCAATATTGTGATGCAGCTGCGCAAGTGCTG
CAACCACCCGTACCTGTTTGAGGGCGCCGAGCCGGGGCCGCCGTACACGACGGACGAGCACCTGGTGTACAACGCCGGCA
AGATGGCGGTGCTGGACCGGCTACTAAAGCGGATGAGCGAGCAGGGCAGCCGGGTGCTCATCTTCTCGCAGATGAGCCGG
TTGCTGGACATCCTGGAGGACTACTGCGTGTTTCGCGGGTACCAATACTGCCGGATCGACGGCAGCACGGCGCACGAGGA
CCGGATCGCGGCCATTGACGAGTACAACAAGCCGGGGTCGGAGAAGTTTGTGTTTCTTCTGACGACGCGGGCCGGTGGTC
TGGGCATCAATCTGACGACGGCCGACATTGTGGTGCTCTACGACAGCGACTGGAACCCGCAGGCGGACCTGCAGGCGATG
GACCGGGCGCACCGCATCGGGCAGACGAAGCAGGTGGTGGTGTACCGGTTCGTGACGGACAATGCGATCGAGGAGAAGGT
GCTAGAGCGGGCAGCGCAGAAGCTGCGGCTAGACCAGCTGGTGATCCAGCAGGGACGGGCGCAGATCGCGGCCAAGGCGG
CGGCCAACAAGGATGAGCTGCTGTCGATGATCCAGCACGGGGCCGAGGCCGTGTTCAGCTCCAAGGGCGGCACGGGGACG
ATGGCCAAGGGGGCGGTAGCCGGCGGCAGCGGCAGCGGCAGCGGCGACAACGGCAAAGCAAATGACAAGGGCAACGCGGA
CGGTGGGATGCACCTAACGGACGAGGACATTGACGCGATCCTGACGAGCGGCGAGTCGCGGACGAAGCAGCTGAACGCAC
GGTACGAGAAGCTGGGGATCGACGACCTGCAAAAGTTCACGTCCGAGTCGGCATACGATTGGAACGGCGAGAACTTTGCG
GCCAAGAAGAAGGACGTTGGGATGACGTGGATCAACCCGGCGAAGCGGGAGCGCAAGGAGCAGATCTACTCGATCGACAA
GTACTACCGACAGGCCATGTATGGCCACGTGGGCCAGCCGAAAGAACAAAAGCCCAAGGCGCCGCGGGCGCCGAAGCAGA
TCTCGATTCAGGACTACCAGTTTTACCCGGAGGCCCTGCGCGAGCTGCAGGAACGCGAGACGGCCTTTTATCGCAAGGAG
ATCGGGTACAAGGTGCCGCTGGCCGACGGCGACGAGGACACGCTGGAGGAGCGGCAGGCACAGCAGGTGACGGAGCAGCG
CGAGATCGACGAGGCGGTAGGCGGCTGACGGAGGAGGAGCAGGAGGAAAAGCAGCGGCTATCGCAGATGGGCTTCGGCGA
CTGGAACCGACGCGACTACCAGCAGTTCATCAACGGGTCAGCCCGGTTCGGCCGGACAGACTACGAGAACATCACGACGG
AAGTCGACAGCAAGACGGCGGCCGAGGTGCGGCAGTACGCCAAGGTGTTCTGGCAGCGGTACGAGGAGATCAGCGACCAT
CACCGGGCGATCAAGACGATTGAGGACGGCGAGGAGAAGCTGCGCAAGATTGAGCACCAGCGCAAGATGCTGCGCAAGAA
GATGCAGCAGTACCGGGTGCCGCTGCAGCAGCTCAAGATCAACTACTCCGTCTCGACGACGAACAAGAAGGTGTATACGG
AGGAAGAGGACCGGTTTCTGCTCGTGCAGCTGGACCGGCTGGGCATTGATTCGGAGGGCATCTACGACAAGATCCGCGAC
GAGATCCGCGAGAGCCCGCTCTTCCGGTTCGACTGGTTCTTCCTCAGCCGAACGCCCAGCGAGCTGAGCCGGCGCTGCAC
GACGCTGCTGACGACGATTGTCAAGGAGTTTGACGACGTGAACACGACGACGACGGCAGCGATAGGCAAGCCGAACGGCC
AGAGCAACGGCCACGGCAACGGCAAGCTGAAACGGGAGGTGGAAGACGAAGAGAACGACGAGGACAGCGTGCTGGGCATG
GCACCGCCGAAGAAGAAGGCGAAGAACGGGGCAAAAGTGAGTGGTGTGGTGGGATGATGGTGATGGGACGACACGGATGG
GAGCTAACGTGCACACAGAACAAAGCACTAGATCATGTCAAGTCCAACGGCACCAAGACGCAGTCGGCAGCCAACTCGCG
GGCGTCCAGCGTGGCCTCGACGCAGTCCAACGCAGGCAACGCCAAGAGCAAGTCCAAGGGCAGGAAGAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62