GenePrediction:GLEAN_7209 Details

Name: GLEAN_7209
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3451155..3448751 (- strand)
Length: 2405
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3451155..3451092 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_140:3450875..3450029 (- strand)
Length: 847
Type: CDS
Source: GLEAN
Position: GCSC_140:3449962..3449858 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_140:3449800..3448872 (- strand)
Length: 929
Type: CDS
Source: GLEAN
Position: GCSC_140:3448818..3448751 (- strand)
Length: 68
>GLEAN_7209 class=GenePrediction position=GCSC_140:3451155..3448751 (- strand)
ATGGCAGACTTTAAAACAGACCTGAAGTACATCTTGGAGGATGCGGGAGATGCCGATCATCATAGTCCCCCGTCTCGCTG
TCCGTCTTCCCTCTGTTCCTCTTTCTGCTTGCGACCACTGCCACTTCCGTTGCCACCCTTATGCCCACCTGCATCGTTTC
CTGCTCCCACTTCTGCCTCTGCCTCGCCCTCGCTCTCGCTCGTGGTCTCGCCCTGTTCCCACCTCACCCCTCCTACTTTC
AGTCTACTAATAAAAGGCCCGCCCCCGTCATCTTCAGCAGACACCAGTAGTCCACACAGACACGCCGAGCTGGAGTCTCA
GTCTCCGTCAAGGTCGACGCCTCGAACCTCACAAGTCGTCCTCCGTGGAAGCAACAGCAACAGCAACGGCCACCACAGCA
GTCACCACGGCAGCCATCACAGCAGCCATCACGGCAGCCACCACAAGAGCCACCGAACAGGCAGCTCTACGAGTAGCTCC
ACAGAGTCCAAGGCCAGGCCAGCCGAAACCTCCGTCGACAACGAAAGCGTCTTTGACCCCAGCTCAACCATGGATCAGAG
AGCATACAGGGCTGCCTCACCCTATCTTCCCACGCGTGGGTACGGCAGTTTGAGTTATGACAGGTACGACGAGAGAACTG
CAGGTTATACTAGCAGCCACAGAGATGGCCGCCTCGCGAGTGACGGTGGCCGTCACTCTGGTGAGAGCCACGACAATCAT
GCTGGCCATGTCGGCCAAAGTAACATAGGCGGCGGCGGCGGCGGTCACAATATGCCGTACAGCATGGAAATGCACGGCGT
AGGATCATCCCCCTTAGGTGCTGGTCCCGGCGTGGTCGCCGAAGGCATGTTAGCCTATGAGACGCCTGTTGCCCGAAACC
AGGCCGGATATGGCCCGGGCCCCTTGATTCCTGCTGGATACGCCATGACTGGTGCAAGCGGAGACATGGTCGTGCAACAG
ACGTTCTTCGCAGCGTCTCCGGGTGATGGCCGTTCTGGAGGCTACCCTGAGGAAGTACGGCTGACGCCAGTCACACGTCG
TGTTAGCCGGGCCAAAAAAGGGGTTCCCGTGCACACATGCGACATTTGTCACCCGGCCAAGGTGTTCACGCGGGCAGAGC
ACTTGCGGTAAGTGAGAGAAAAAGATGAGGAGGCAAGGTCGGCCAGTCACGGATGGCTAATCTCTCTCCTCAGGCGTCAC
CAACTGAGCCACCAGACGCCGCACTTTCAGTGCACTTACCACCAGTGTCGCCGTTCCTTCCACCGGGCCGATCTTCTCAG
CCGCCACGAGCGAAGACAGTGAGTGCAGAAAGCGATGAAAGCCGACGAAATCAGGAGACTGACCCACATACACAGCCGAT
CTGGAGAAGAGCTCACCCCGGGTGGTGGCATGGAGCCTGGACTGTCCGCACGCCGAGACTCGTCGCAGTCAATCGACTCC
AGCGTGGGGTATCAAAGCGCCTATGTCAGTGAGGGAGGGGGGGAGGACCAGGAGATGGAGACAGGAGGCCAGCGTCATGC
TGAAGAAGGAGTAGCAGCAGACCGAGAGCAGCATTACCACCAGCAATACCAACAACAGTTCTCATATTACTCGTCTGGAG
GTTCTGGCTCCGGCTATGGTGACCAAGTGAACAATCTGGCTGCCAGTATGATGGGAAAACATGATGCTGGTGGAAGAAGG
AGTGTGCAATACTGTGTCGCGAGTACCAACCCGCATACAGCTAGTCAAGGGACTTACGGTGCTGCCAAGAGCCAATATGA
TGGCCAGATGAAGTATTCGCCTCGCCGGCAACGAGGTGCGTATACCACAACCCGGGCCCCGGCTATGCCAGACTTCACAT
CCAAGTCTGCCGGAGCATCTGCTGCGCAGGACTTGCTTGCCTATGTTGGCGACCCTCAGTTCTGCAGACGAGAAATCACA
GCTAGCTCAGCGGTTACTTTTACCTCTGATTATCTCCATGCGACCGATCTGCGGCTACGCTCGCAGGGGCATCAACATCA
ATACGGCAAGAGTGCTTCAGCTCCAGAATGGTCCACATTAGCTGGCGGCAACACAAACGCGAGCTTCAACTATCCGTACA
CATTGCACTCGCTCTTTGACGATCATCACTGCGTTCCATTATCCGTGACACCACTGCCAGAGAACTCGTCTGGCTGGGAG
TCCTTAGCACCAGCTCTCGGGGATGCTGAGAGCACACTGGCTACGACATATGCCCGGGCATCAATCCCTCCACAGGCCTC
ATTAGTCGGCGAACAGGACAGCGTGCTCCCACGACAGGCTAACAGTGAGATAAGAAAAAGAAGAAGCAGGAGTAAGAGTA
TTAGCCCTGCTGCTCAGGCACCGCTCCTGTCAACGGCCTCGTCGGCCCCGTCATCTTCTGGAAGCGACACCCCGCCGCTG
CCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62