GenePrediction:GLEAN_720 Details

Name: GLEAN_720
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1637252..1638170 (+ strand)
Length: 919
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1637252..1637409 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_97:1637624..1638170 (+ strand)
Length: 547
>GLEAN_720 class=GenePrediction position=GCSC_97:1637252..1638170 (+ strand)
ATGGCTGGTGGCAAGAAGGGCGGCGACATGAGCAAGAAGGCGCAGGGACAGGCACGCAAGGCGGATGCGGCCTCGCAGAA
AGCAGCTGCAGAAGACGCCCAGCGGGAGGCGACAGAGTCTGCCGAGTGGACCAAGGGGTCGAAGAGCAATGCGAAAAAGT
GAGACCAGGCAGACGCCTTGCATTCTGCACAGTCCGCGGCCCCGCTGGAGAGTGATTTTGTTGTCATTCCTGACTCTTCG
TCTTCTTTCCTTCTTTTCTTCTTTCCTTCTTTTATTTTATTTTATTGTTTTCCTTTCTTTTTCCTTTCTTTTTTTCCCTC
TTTCTTCTGTCGTCTTTCGTTTTCGCGTCTGTCCTGCTGACCAGGACGATAGAGAGGCCGAGGCTGCAAAAAAGGCCGAA
CAGGCCCGCAAGAAGAGCGAGCGCGAGGCGCTGCTAGCCGAGGAGGAGCGCAGCTTGCCTGGCCGGGCAGCGCCCAAGAA
TGCCAAGTCAGCCGGCAAGAAGACGAGCGCGGCAGCGGCGGTGACGGCTCCGTCGCGGAAACTAGACCTGTCGCAGCTAG
ACGGCGACGACAGCAGCCTGGCGGCAGTCAACGCATCGGGCATCGACAATGCGCTCGACGCGCTGTCGCTCGACCACGAC
GCGGCATCGGGAGCCGGGGCGATTGACCGGCACCCGGAGCGGCGATTCAAGGCGGCGTATGCAGCCTTTGAAGAGCGGCG
GCTGGAGGAGATGGACAACGACGGGTCGGGCAAGGGCCTCCGGCTGAACCAGCGCAAGGAGCGGCTGCGCAAGGAGTTTG
AGAAGAGTCCGGAGAACCCGTTCAACCAGGTGACCGGTCGGTTCGACTCGACGCGCGAGGAGCTGGCGCAGATTCACGCG
CAGGAGAAGGGCAAGATTGAGCGGCGGCTGGGAGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62