GenePrediction:GLEAN_7210 Details

Name: GLEAN_7210
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3446681..3443999 (- strand)
Length: 2683
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3446681..3446659 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_140:3446511..3446376 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_140:3446269..3446201 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_140:3445795..3443999 (- strand)
Length: 1797
>GLEAN_7210 class=GenePrediction position=GCSC_140:3446681..3443999 (- strand)
ATGGGCACTTTTGTCTTCAAGTGGTGAGTCGTCGCATGATGATGGCCGTCGTTGTGAAAGCGGCTGCTACCAGCGCCACG
TCTCTGTGGTGGCAGCCCTAGGCAGCCGAATTGCGCTCTTCCATCTTCTGCGCATTCCTCCGAGCTGACATATCTCCTCG
TTTGCACCAGGCCGAGGGATGCCGACGAGGTTTACGTCACGGGCACATTTGACGACTGGTCCAAGTCCGTCAAGCTCGAC
AAGATCGTCGACTCGTTTGAGAAGGAGGTCGAGCTCGCCGATGCCTCCACCAAGATCTACTACAAGGTGTGTATCTTGAT
TCCGTATGACCGTATGGTCCCTGCTTTGACTCTGATTTTTGCGTGTCCCTGTTCGTGATCATGTCTCGTCTCTCTTCCCT
TTCTCTCCGCAGCCACTTGCCACAATGGCCATTGAGGCCGGGGCCCCAGCCGTGCATCCTGCTGTCGATCGGAGGGGCAA
GGTTAGCCTGGCGTGGATTTGTCTCACCCACATCCATAACACATCTCTTTCCAGCGTTCTATGTATGACGCAAGGGGCAA
CAGTGGCCGCCGTAGGGCCATGCACCTGCGGAGACCCTCGTCGTTCGCTAGCCAGCTCATGTGCTTTTTTCTCAGCCCCA
ACCTCCCTGTTTTAGAGCAGACATGGGCACGCAGCTCTAATGCACACCACATGCCACATTCCCCAGTCCACATTCCCCGC
CGTCTTCCCCTCTATGTCTGCACGATCTCTTCCCCTCCACCCCCCTCTTTCACCGCTCTCAAACATCTCGATCCTGCATC
TCGATCCTACATCAGCTGTTGTGCTTGCCGTTCACCTTTCATGGTACCGTGTCCTTTCACACGTATTAACCTGCCATCAT
ATATAGTTTGTCGTTGACGGCGAGTGGGTTACCGACGGTGACGCTCCGAAAGAAAAGGACGAGGGTGGTAACGACAACAA
CGTTTTGACGCCGGAAAATATCGTCAAGCTGGCACCTGGTACTGCTACCATCTTGTCATCTGCTGCTCCGACATCGACAA
CTGTTCTGCTGGCCAAAGACGTGCCGCTAGAAGAGAAGAAGCAGGTCAAGGTCACAGAACCTGAGACACTCGTTGAGCCT
GTAACAGTCGCTGAGCCGGTTGTTGCCGAGGAGAAGACCATGGACAAGGTTGAGGAGCCGACCTCTGCTACCGAAGTGGC
TGTGCCTGTTGCCGCTGCGGCTGCTGCTACCGTCACCACGGTCGAGTCTTCAGACGAAAAGCCGACCATGTCCGAAAGCA
GCGAAGTTCCGGGCGCGTTCCCGGAAACGCCCATTGCAGAGCTGGACAAGGACGTCAAGCTGATCAACCCCCTGCCGGCT
GCACCGGGAGGTGTGAACCCGATCAAGCTGGCACCAGGCGAGAAGATCCCCGAGTCGCTGACAACGGCCGACGTCAACAC
GAATGTCAAGCTTGACCCGGAGTCGTACGAGAAGGCTGACGCCATGGTCGGTGGCGTGACTCTTGACCAGTTACCGCCCG
TGTCCAACAACATGATCCCAGAGTCCAGCCTGCCCATCGCCTCTCACGATGATGTCACGATTAGCTCTGTCGCCCCCGTT
GCAACCACGGCTGTTCTGGCCGCAGCCGTTCCTCTGGAGAAGGACGAGGCCGATGCTGTTGCTGCTGTTGCCGTTGTCAC
ACCGGCCCCGGTCGTCTCTTCACCCGAGACTGCTGTGACTAGCGAGGTGCCTGAGATTGTCAAGGAGAGCCAGGCCGAGG
CCAATGTGCCTGCCGAGGCGTCTGGCGTCCCGGAAGAGGTGAAGGAGAAGGAGCTGGTGGAAGAGGAGCTGCTGTCCAAG
GTTCCCGAAGCACCTGTCACCTCAGACGGCACGACGACGACATCCCCGGACACCAAGGCTGCGGCTGCCGGTGTTGTCGG
TGGTGCGGCTGCGGTTGTCGCTGGTCTGGGCACCATTGCCTACGCCACTGCCACAGCAGCCAAGGACAAAGCGGTGGAGC
ACGGCGTGCCGGCCGCTGAGAAGGCGTCTGCTGCTGCGAGTGAGGCTGCTACCAAGCTGCCGGTGTCGGTGAAGCAGTTG
CTGCCGACTGCCGTCCAGGAGAAGATTGCCTTGACGAGCGCCACGAGCGCCACGACCGAGGGTCCTGCGACCACGGCCGA
GGTGCCTGCCGAGGTGAAGGAGTCGATCCAGGAAGCCGATGTCAGCCCGGAGGCAGCAGCGAACCCGGTTGCCGTGGAGG
AGAAGAGCGCGGTGGAGGCTGAGCTGCTCAAGAAGACATCTGAGCCGGTGGCCGTGCCAGTCGTTGCTGAGCCTGTCGCC
GAGCCTGTTGTCGAGTCCGTCGCCGAGCCCATCGCTGAGCCTGTTGTCCAGCCCGTTGTCGAGTCTGTGGCTGAGCCCGT
CGCTGAGCCTGTCGCTGAGCCGATTGCCGAGTCGACTGCTGCACCTGTGACGACGGAACCCACGGCAGCTGTGGTCAACG
ACAAGGACACCCTCGCGGCTACTCCAGCTGCTGAGGTCGTGGATGCCTCGTCTTCCGCTCCGGCAGCATCTCCGAATGCT
GTGGCGCCGACGACTGCATCGGCCGGGTCTCTGACGTCGACTGAGCGGAAGAAGAAGCACCGGATCAGCGGCTTCTTCAG
CAAGCTTCTTCACCGGTTCGACGGCGGCGACAAGAAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62