GenePrediction:GLEAN_7214 Details

Name: GLEAN_7214
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3417999..3416522 (- strand)
Length: 1478
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3417999..3417986 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_140:3417924..3417487 (- strand)
Length: 438
Type: CDS
Source: GLEAN
Position: GCSC_140:3417415..3416809 (- strand)
Length: 607
Type: CDS
Source: GLEAN
Position: GCSC_140:3416743..3416522 (- strand)
Length: 222
>GLEAN_7214 class=GenePrediction position=GCSC_140:3417999..3416522 (- strand)
ATGCGGCAACAGCAGTGCGTATCTTTCCATGGCCCATATTTGCATGTCCCATCGCTGACTCCTCTCAGTTGGCAGTCAGT
TCTGGCAGCAGCTGTGTCAGGAGCACGGCATCAGCCAGGACGGCAACCTCGAGGAGTTTGCCACCGAGGGCGGCGACCGC
AAAGATGTCTTCTATTATCAGAGCGACGACACCCGCTACATTCCACGGGCCATCCTGATCGACCTGGAGCCGCGCGTGAT
CAACGGCATCCAGACCGGCCCCTACAAGAACATCTACAACCCGGAGAACTTCTTCATTGGCAAGAACGGCATCGGCGCCG
GCAACAACTGGGGCGATGGCTACCAGACCGGCGAGTCCGTCCACGAGGAGATCATGGAGATGATTGACCGCGAGGCTGAC
GGCAGCGACTCGCTCGAGGGCTTCATGCTGCTGCACTCCATCGCTGGTGGAACCGGCTCCGGTCTCGGCTCTTTCCTGCT
CGAGCGCCTCAACGACCGATTCCCCCAAAAAAGGTCATCCAGACCTACTCCGTCTTCCCCGACACCAGCAGCGCCGGTGA
CGTCGTCGTCCATCCCTACAACAGCATTCTCGCCATGCGCCGCCTCGTCCAGAATGCCGACTCCGTCGTCGTCCTCGACA
ATGGCGCCCTGTCCCACATCGCCGCCGATCGTCTGCATGTCCAGGAGCCGTCCTTCCAGCAGACCAACCAGCTGGTCTCC
ACCGTCATGTCAGCCAGCACCACCACCCTCCGATACCCCAGCTACATGCACAACGACCTTGTCAGCATTTTGGCCTCGCT
CATCCCAACCCCTCGCTCCCACTTCCTCATGACTGCCTACACCCCCTTCACCGGCGACCAGGTCGAACAGGCAAAGACCG
TCCGCAAGACCACCGTGCTCGACGTCATGCGCCGTCTGCTGCAGCCCAAGAACCGCATGGTGTCTACCACCTTTGGTGGC
AAGGCCAGCCGCAAGAGCTGCTACATCTCCATCCTCAACGTCATCCAGGGCGAAGTCGACCCCACCGACGTCCACAAAAG
CTTGCTGCGTATCCGCGAGCGCCGCCTGGCCACCTTCATTCCCTGGGGACCGGCCAGCATCCAGGTCGCTTTGACCAAGC
GCAGCCCCTATGTCCCCATGAGCCACCGCGTGAGCGGACTGATGCTGGCCAACCACACAAGCATAGCCACGGTATGTCGC
ATGATTATCCCCCCCGTGCTTCACCTCTTCGTTGTAGATTTGCTCATCCCATCCAGCTCTTCAAACGCATCGTCCGCCAG
TACGACGGCATGCGAAAGCGAAATGCCTTTATCGATGCATACAGAAAGACTGCCCCATTTTCCGACAATTTAAACGAGTT
TGATGAAGCCAGGGAGGTCGTGGCTGACCTAATCGCCGAGTATGAAGCTGCCGAGGAGGGAGACTACCTCAGCCCACCCG
CTGAGAAGGAAGGGGCGGTTGATATAAATAATAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62