GenePrediction:GLEAN_7216 Details

Name: GLEAN_7216
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3408179..3406332 (- strand)
Length: 1848
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3408179..3407869 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_140:3407805..3406332 (- strand)
Length: 1474
>GLEAN_7216 class=GenePrediction position=GCSC_140:3408179..3406332 (- strand)
ATGGACGGCGAAGGCACAATATCATTCCGAGGCGTCAAGATGGAGGAAGCCGCCCCGACCGCGACAGATCTAGTAGCGGC
ATCACCACTGCCTACGACTGCAGCATCCTCAACCTCCCATAATAACGCCGAGATCGACGATGCTAAGAGCAAGACAAAGC
CGTCCCAGGGCGTGATGCCCTACCGCTCGTGGAAGAGGAAGCACCTAAAGATGCGCCTTGCCTTTGAGGAGAAGATGGAG
GCCAATGCGAGGCTGCATGCTGAGGAGGTCAAGGCCATCCAGACGAGCAAGCGTCTAGCAGTAGAGATTGAGTAAGAAGG
CCTCCCGCGCGCATTGTCTTTTCGTTCTTGTCTGTACTGACAAACTGTAAACAGCCGAGTTCTCGACCTGCTCCTCGATG
TCAACAATTCGGCTCAGATCCCGGGATCCAAGCGCATCGATCTCAGTCTGACCTCATCGGACGAGTCGTCGAAGCTCACC
AGCCTCGATATTGACCACAAAGGCGGCTGGGCCAAGCGCTTTTCCGACAAGAGCGACCCTCAGGCACCACCTCCCGAACT
GCCTGCCAAGTCGCTGCAGTCACTACTCCATGATGTGCGACACGTCAATCTTGCCGCCGCAAATCGCGGTCTACCGTCAC
TCCTCAAGGACTTGGTTGCAGGCGATGATAACAAGCTCGCCTTTGTTGTCCCGACCGGAAAAAACTCTCCCCAGCAGCAT
CCACAGCAGAAGCTCAAGCATTATCCGGAGAGCTTCCTGTCCGCCGATGACATCGACAATTACCTGTGGGAGGTCGACCG
CAACGTGGCCGGACATGTTCTTCTGGCCGGCCAGACCCCGCCGCCAATGCTTCCGACGTTGGCCCCCTTTGCACACATGG
TCGACACGCACACGCCGACGGCCAACGGTGGTAGCAGTGGGTGGGAAGAGTTTTTCAACCGAAGCATCTCAAAGACGGAC
CTGCCATCAATTTACGGAGCGTCAATGACAGCGACCACGCGCGACAGCATTCTGCGCAACCCGACAAGCGTCTTCAACTG
GCTCAAAAAGAACGCGCCCAAGGCCGTCTTTTTGCAGGAGGGTGAGGCTACGGCAGCTGCTGCAGCCGACCGCGAGAACA
GCAACAACGGTCATTACAATCACGGCGATGACTACCACCACTACTCGTATGGCGGTGCTGGTAACCAGAACGGTGCTGGT
GGTGGCGGTGGCGGCAGTGGAGCGCCGACAGCGCGTGGCCGCAAGTCCGTGGGTGGGAGCGGCGTCGAGAGGACGGCGAG
CAGCCGTGGTGGAGGACGTAAGCGAGCCTCGGCGGTGATTCCTCTGCGTGAGCATCTGGCGGTGGACGGGGTGGAATCAG
ACGACCTGTCGCATGAACTGGCGACGCCTCGGGCTATGGGGCCAACGGGCAGCGGTGGCCGAGGTGGCAAGCGGAAGCGG
CCAATGCAGGACGACGATGCCGGCTACCGGCCAAGGGCAAGCACCGGGGCCGGAGCTGGTGTCGGGGCTACGCCCACTGG
AGCCGGCGGCAGCAGTGGCCGTGGGACGAAGCGGAAGCGGAAGAGCGAGGGCGGTCTGGGCGACATGACAAATACGATCA
CCAGCACGTTGTCATCGATGGCGGCCAAGAAGGCGCGTAAGAGCGGAGACGCGGCAGCAGCGGCGACAGTAGCAGCAGCA
AGAGAAGCGGCCGAAACAGTCGATGTGGCCGAAACGGTGGCAGCTGCAGACGGAGACGATCTGGACATGGCCGAAGGTGA
AGCAGAAGCAGACGGCGGCGGTGGCGGCGGCGGCGGGGATGACGACGACGACGTCGATGAAGACGACGATGCATCGACGG
CCGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62