GenePrediction:GLEAN_7217 Details

Name: GLEAN_7217
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3394590..3393911 (- strand)
Length: 680
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3394590..3394584 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_140:3394511..3394333 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_140:3394266..3394033 (- strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_140:3393979..3393911 (- strand)
Length: 69
>GLEAN_7217 class=GenePrediction position=GCSC_140:3394590..3393911 (- strand)
ATGAAAGGTGAGCCTGGCCGACGGTCCATGCCAGCCGGCAGGGCGGGTTCGGGTTGCTGACCTGTCCTACTATGAATAGC
GATTCTGCAGCGCGTCGTCTCCGCCTCGGTGACGGTCGAGAAGGAGCTCGTGTCGTCCATCGGCCGGGGCGTGCTGGTGC
TGGCAGCCGTGGCACCGGGCGACACCGAGAAGGAGGCCGACTCGCTGGCGGCCAAGATCGTCAAGCTGCGGCTGTGGGAT
GATGACGAGGGAGGCACAGTGCGCGCGACAATCCCGTCTGACGTGTTCGTGTTATTTGTTGTCTTGCTGACATGTACGTT
CTAGTGGAAGAAGAGCGTGGCCGACATTGGCGGCGAGGTGCTCTGCGTGTCCCAGTTCACGCTCTTCGCTTCGACCAAGA
AGAGCAAGCCGTCGTTTAGCGGTGCGATGGGCGGGGACGAGGCCAAGCGGCTCTACGACTACTTTGTGCAAAAGGTGCGC
GACAGCTACCAGGCCGATCGCGTCCAGGACGGCGTGTTCCGCGCCATGATGCAGGTCGCTCTGGTGAATGATGGGCCGGT
AGGTGTCTTCTGCCGTCTCCCCGCGTATCACTCCACGTCTGACATCGACAGGTCACGATCGAGGTATCGGCCCAGCCAAA
GCCGCATCCAGACAAGAAAGCGCAGGATGGGGTGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62